‘Gerçek Bilim’ vs. ‘Kâbus Film’ – 1. Bölüm

‘Gerçek Bilim’ vs. ‘Kâbus Film’ – 1. Bölüm

İki tıp sisteminin karşılaştırmasını sunuyoruz; biri Pastör’ün mikrop teorisine [monomorfizm/tek biçimci ekol] dayanıyor, diğeri Béchamp’ın hücre teorisine [pleomorfizim/çokbiçimci ekol].

Mikrop teorisine göre dışarıda hazır bekleyen mikroplar var ve bunlar insan bedenine girerek nedensiz yere hasta ediyor.

Hücre teorisine göre ise bedenimizdeki ölümsüz organizmaların kirlenen iç ortamın gerektirdiği şekilde temizleme – yıkımlama – dönüştürme görevlerini ifa için girdiği değişik biçim ve çalışmalarının sonucu olarak açığa çıkan metabolik atıkların oluşturduğu yük yüzünden rahatsızlık yaşıyoruz.

“Organizma değil hasta eden, o organizmaların metabolik faaliyet sonucu ortaya çıkardığı atık ürünler. İnsan bedeninde metabolizma tamamen dengedeyse hiçbir hastalığın oluşması mümkün değildir”

– 1944, The Smithsonian Enstitüsü yıllık raporu, Rife Mikroskobu).

Hastalık Paradigması

“Bir düşünce akımı (modern tıp ve monomorfik perspektif) diyor ki, hasta düşmemizin sebebi ekseriya statik, hastalık yapıcı bir tür mikroptur (mikrop teorisi). İyileşmek için mikrobu ÖLDÜRMEK gerekir. Seni hasta eden şey neyse onu ÖLDÜRMELİSİN. İlaçtır, antibiyotiktir, kemoterapidir, radyasyondur, ameliyattır; ÖLDÜR AT.  

Diğer bir düşünce akımı (hakim tıp dışında kalan diğer çoğu iyileştirme sanatı bu kategoriye giriyor) da diyor ki, hastalıkların çoğu bedendeki dengenin bir şekilde bozulması yüzünden oluşuyor. Ya beslenmede, ya elektrik sistemimizde, yapısal, toksikolojik veya biyolojik denklemimizde, bir yerde denge şaşmış oluyor. Iyileşmek için ise vücudumuzu yapmaya çalıştığı şeyin tersine zorlamak yerine onunla işbirliği yapıp, işine yardımcı olmak suretiyle dengeyi yeniden sağlamamız gerekiyor.”

Görülebileceği gibi, Béchamp’ın hücre teorisi Batı tıbbının bugünkü uygulanış şekliyle taban tabana zıt.

Batı tıbbı olarak adlandırılan hakim sistem mikrop teorisinin ve elbette ABD’de 1910’da hazırlanan Flexner Raporu’nun ürünü. Finansmanını ülkede petrol kaynakları ve demiryolu kurulum ve işletim ağlarının sahibi işadamlarının sağladığı bu raporla, ülkede tıp eğitiminin kalitesinin mikrop teorisi eksenli olarak artırılması gerektiği sonucu üzerinden, o zamanki hâkim tıp sistemleri olan naturapati ve homeopati eğitim kurumları ve hastaneleri hızla kapatılarak, yer yer iş 4 katlı doğal bilimler kütüphanelerinin yakılmasına kadar vardırılarak, mikropla mütemadi savaş mantığı üzerinden petrokimya ürünü ilaçların dispanseri konumuna gelen allopatik tıp modeli “modern”, “gelişmiş” ve “bilimsel” etiketleri ile yaygınlaştırılıp, neredeyse zorla yerleştiriliyor.

İntihal ve bilimsel aldatma suçları işlediğine dair kanıtların yayımlandığı kitapları Princeton Üniversitesi yayınları arasında bulabileceğiniz Lui Pastör’ün iddiası, belli birtakım mikropların belli birtakım hastalıkları oluşturduğu yönünde. O halde mikrobu öldürdük mü hastalığı da kontrol altına aldık demektir diye düşünüyoruz. Ve fakat bu düz mantığın bizi bugün getirdiği nokta pek de beklenildiği gibi değil. Bu tıp ekolünün kalesi olan ABD’de sağlık sistemi yarattığı hastalık yükü nedeniyle kendi üzerine çökmek üzere, insan ömrü ortalaması düşüşte, tıbbın elinde hayatını kaybedenlerin sayısı eskiden savaşlarda yitirenleri çoktan geçmiş durumda.

Pastör’ün teorisi monomorfizm temeline dayanıyor. Değişmez, sabit mikroplar var ve bunların herbiri kendine özgü, ayrı bir hastalık yaratıyor inancı bu. Oysa Béchamp ve Profesör Claude Bernard gibi kendi çağdaşlarının savı pleomorfizme dayanıyor; buna göre hücreler, bilhassa tek hücreli mikroorganizmalar belli koşullar altında biçim değiştirerek farklı hücre tiplerine dönüşüyor. Bu bilimadamlarının dediğine göre, mikrop nereden çıkmış olursa olsun, ancak ve ancak bedenin “iç ekolojisi” birtakım nedenlerle yıpranmış ve denge bozulmuş haldeyse tehlike oluşturabilir.

Kendini bilime adamış, kendi halindeki bu ahlâklı bilimadamlarının değil, gün, saraydan kendine maaş bağlatmayı başaran Pastör’ün oluyor ve tüm dünya mikrop teorisini doğru kabul ediyor.

Yanlış işte burada başlıyor ve 19. yüzyıl sona ererken bir yanda Béchamp, Enderlein ve İsveç’ten Ernst Almquist (1852-1946)’in pleomorfizmi, diğer yanda da Pastör ve Robert Koch’un (1843-1910) monomorfizmi şeklinde iki ayrı düşünce kampı beliriyor.


Pastörcü Mikrop Teorisi ile Béchamp’ın Hücre Teorisinin Karşılaştırması

MİKROP TEORİSİ (Pastör)HÜCRE TEORİSİ (Beschamp)
1. Vücut dışından aldığımız mikroorganizmalar yüzünden hasta oluruz.1. Hastalığı yapan vücut içindeki mikroorganizmalardır. 
2. Mikroorganizmalardan mümkün mertebe kaçınmak gerekir.2. Hücre içindeki bu mikroorganizmalar normalde bedenin metabolik faaliyetlerini yürütmesine yardımcı olur, bu işe yarar.
3. Mikroorganizmaların işi sabittir, değişmez; hep aynı işi görür.3. Organizma öldüğünde yahut yaralandığında, bu mikroorganizmalar şekil değiştirerek bu defa da bedenin katabolik (yıkımlayıcı, parçalayıp ortadan kaldırıcı) proseslerine yardımcı olmaya girişirler ki bahsi geçen yıkımlama prosesi kimyasal da olabilir mekanik de. 
4. Mikroorganizmaların rengi, şekli de bellidir; sabit kalır, değişmez.4. Mikroorganizmalar, içinde bulunduğu “ortam”ı [vasat; besiyeri] yansıtacak şekilde renk ve şekil değiştirirler. 
5. Her hastalığın altında bir mikroorganizma yatar.5. Hastalıkların her biri belli durum ve koşullarda ortaya çıkar.
6. Hastalık oluşumunun baş aktörü, birinci dereceden fail mikroorganizmalardır. Konakçı organizma güçten düştükçe, mikrororganizmalar da “patojenik” (hastalık yapıcı) hale geçer. 6. O yüzden de, hastalığın birinci derecede müsebbibi konakçı organizmanın hâl ve durumudur [kondüsyon].
7. Hastalık herkesi “vurabilir”. İş, mikropla karşılaşmana bakar.7. Hastalık, sağlıksız koşullar varsa ortaya çıkar.
8. Hasta olmamak için kişi gardını kuvvetlendirmeli,etrafına  “defansif duvarlar” örmelidir.8. Hasta olmamak için sağlık yaratmak, kendine bakmak gerekir. 

Son yüzyıla baktığımızda da hakim bilim ve tıbbın monomorfizm teorisinin yanlışlığını ortaya koyan bilimadamı doktorları görüyoruz; Enderlein, Rife, Reich, Livingston-Wheeler, Naessens ve daha genç kuşaktan ABD’den Dr. Robert O. Young (San Diego) ve Dr. David Jubb (New York) bu isimler arasında sayılabilir.

Royal Raymond Rife ve kendi icadı olan Üniversal Rife Mikroskobu. ABD Tabipler Birliği (AMA) patentini edinmeye çalışıp başarılı olamayınca laboratuvar FDA tarafından basılıp cihaza el konuluyor.

Monomorfizm ve pleomorfizm teorileri arasındaki farklar, kullanılan mikroskopi teknikleri ve numunelerin hazırlanış şeklinden ileri geliyor. İşin can alıcı noktası da bu, diyebiliriz. Pastör zamanında ve tabii 20. yüzyıla girilme aşamasında kullanılan mikroskoplar 1000 katlık büyütme gücüne sahip ve incelenmek üzere alınan kan örnekleri de kimyasalla boyama işlemine tabi tutuluyor. Bu boyaların ise kanda canlı ne organizma varsa öldürdüğü unutulmamalı.

Gaston Naessens ve Somatid Mikroskobu

Öte yandan, Rife, Livingstone, Naessens gibi bilimadamlarının kullandığı mikroskoplar 20.000 ila 30.000 katlık büyütme gücüne sahip ve bu teknikte numuneler boyanmıyor. Düşük güçteki mikroskoplar “virüs” (eksozom) boyutundaki partiküllerden daha küçük bir şey varsa seçemiyor ve elbette renk ayırt edemiyor. Oysa Rife, Livingstone ve Naessens’ın kendi tasarladıkları özel yapım mikroskoplarda kanda yaşayan ne organizma varsa en küçüğüne kadar görebiliyor, hareketlerini dahi gözlemleyebiliyorsunuz. [Bu üç bilimadamının da resmi makamlarca [Amerikan Tabipler Birliği (AMA), Gıda ve İlaç İdaresi FDA ve Kanada’daki muadili kuruluş] çalışmalarının engellendiğini ve hapse atılmaya çalışıldıklarını biliyoruz.]

Naessens’in geliştirdiği kanser/aids/otoimmün hastalık ilacı insan iyileştirmeye başlayınca hapse gönderilmek üzere düğmeye basılıyor. Hastaları ve sevenleri mahkeme önünde lehinde protesto düzenliyor.

Pleomorfizm: Béchamp kendi zamanında, tüm hayvan ve bitki hücrelerinde bulunan ve canlı öldükten sonra dahi yaşamanı sürdüren, hatta kendisinden birtakım mikroorganizmalar da türeyebilen mini minnacık parçacıkların varlığını kanıtlıyor. Mycrozymas (Mikrozimler) isimli kitabında Béchamp’ın pleomorfizm konseptinin temellerini attığını görüyoruz.

Doğa gözlemlerimizden biliyoruzdur, ne zaman bir canlı yaşamının sonuna gelse çürümeye başlar, bir şeyler bedeni yavaş yavaş yer, yok eder. Aynının hücrenizde gerçekleştiğini düşünün şimdi. Hücre içi ortam sağlığını kaybedip değişmeye başladığında mikrozimler (Naessens’in ‘somatid’i, Enderlein’ın ‘protit’i) sinyali alarak mikrobik yapılara dönüşmeye başlar ve kendi doku hücrelerinizden çıkarak bedende nerede bir toksin (zehirleyici madde) veya çürümeye yüz tutmuş yer varsa burayı yıkımlayıp çeri çöpü temizlemeye girişir [INfection vs OUTfection!]. Mikrop dediğimiz yapıların işi, görevi budur.

Béchamp der ki, mikrobik yapılar hastalık durumunun ortaya çıkardığı SONUÇTUR, sorunun/hastalığın kaynağı değil!

Enderlein’ın ‘protit’ dediği bu inanılmaz derecede küçük organizmalar (somatid/mikrozim) havada, suda içtiğiniz şarapta vs hep var ve görevleri de yine kendisine göre şeker yemek. Bitki veya hayvan, yaşayan her canlıda olduğu gibi bu protitler dediğimiz gibi, her yerdeler. Şarap örneğinden gidecek olursak, form değiştirip maya hücrelerine gönüşüyorlar ve görevlerini, yani üzümün şekerini yiyip fermante etme işini ifa ediyorlar.

Somatit / Protit / Mikrozim Nedir?

Büyüklükleri bakımından kabaca fikir vermek üzere çizilmiş görsel,; tam orantıyı yansıtmıyor.

Naessens’in mikroskobuyla alınmış görüntü. Okla işaret edilen minik parlak noktalar, somatid/protitler. İçi boş büyük daireler şeklinde görülenler de alyuvarlar.

Bu minik parlak tanecikler tüm fiziksel yaşamın başlangıcı ve sonu aynı zamanda. Bechamp’a göre tüm hücreler, organlar ve yaşam formları bu “minik taneler” sayesinde vücut buluyor. Protitler, içinde bulunduğu organizma ölse dahi yaşamaya devam ediyor ve kendisinden birtakım mikroorganizmalar ürüyor.

Naessens işte Béchamp’ın bu dediğini mikroskobu ile canlı olarak izliyor ve kaydediyor. Bu görüntülere ve Naessens’in açıklamalarına dair yazıyı burada bulabilirsiniz.

Naessens’in bahsettiği somatit/protid/mikrozim yaşam döngüsü şuna benziyor:


Somatid yapılarının verim döngüsünü görüyorsunuz; aynı organizma ortam koşullarının gerektirdiği şekilde biçim değiştirerek (pleomorfizm) spor, bakteri ve mantar yapılarına dönüşüyor. Bu yapıların kaynağı olan somatidler vücut dışından gelmiyor, bizzat hücrelerimizin içinde, kanımızda, lenfimizde mevcutlar. Vücut iç ekolojisinde denge bozulduğunda, göreve koşuyorlar.




Devam edecek…

Somatoscope

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını göstermiştir.)

Sormamız gereken önemli bir soru var:
Modern tıp neden bu büyük çalışma sahasını ve bedendeki bu temel hücrelerin tüm serisini görmezden geliyor?

ÇALIŞMANIN ÖZETİ:

Naessens, 30bin çapta büyütmeye imkan sağlayan yüksek çözünürlüklü (150 angstrom), Somatoskop olarak adlandırdığı kendi tasarımı olan bir ışık mikroskobu geliştirmiştir.

Bu sayede bakteri ve diğer mikroorganizmaların; daha yüksek seviye organizmalara ait dejenere olmuş/bozulmuş hücre altı düzeydeki parçalarından kaynaklandığını gösteren Bechamp, Rife ve Enderlein’ı takip edebilmiştir. Bizim daha önceden “mikrozim” ya da “protit” olarak adlandırdıklarımıza Naessens “somatid” diyor. Bu yapı; canlının ölümünden bile sağ çıkabilen, yaşamın ölümsüz bir parçacığıdır.

Kişi sağlıklı değilse; Somatid, her aşaması bağımsız bir canlılık ve üreme kabiliyetinde olan, dejenerasyon (bozulma) ve rejenerasyondan (yenilenme) oluşan çok basamaklı bir döngüden geçer. Somatidlerin bozulmuş basamakları, asitte ve asid tabanlı (ya da asit baz?) durumlarda bakterileri ve diğer mikroorganizmaları meydana getirir.

“…Somatidler yok edilemezler. Isı ya da herhangi bir kimyasal ürün tarafından öldürülemezler. İkinci olarak, Somatid her türlü hücre bölünmesinde mevcut olmak zorundadır. Somatid; büyüme hormonuna, o da hücrenin doğru bir şekilde bölünmesine olanak verir. Büyüme hormonunu salgılayan Somatid değildir. Somatid’in değişimi sırasında büyüme hormonu açığa çıkar, fakat bu Somatid’in bir salgısı değildir. Somatid, kırmızı kan hücresi içindeki bir sıvı yapı içerisinde meydana gelir. Somatid’in her değişimi, yeni büyüme hormonlarının salgılanmasına sebep olur. Aynı zamanda Somatidlerin elektrik yüklü parçacıklar olduğunu vurgulamıştır. Zarı negatif yüklüyken çekirdeği pozitif yüklüdür. Bu durum, preparatların yakınına bir mıknatısın pozitif kutbunu yaklaştırarak ispatlanabilir. Tüm Somatidler mıknatısın pozitif kutbuna çekilir.”

Somatidlere zarar veren zehirli ilaç ve aşıları bize satmak amacıyla R.ckefeller temelli modern tıbbın isteyerek bilmezden geldiği bu anlayışla görebiliriz ki yanlış bir enfeksiyon fikriyle hareket ediyorlar.

Hastalıklar içten köken alır. Bakteriyel kontaminasyonla bulaşma ancak yatkın (toksik/zehir yüklü) kişilerde vuku bulur. Ve diğer bulaşmalar da, çinlilerin çok iyi bildiği gibi, hava koşullarından, duygusal şok ve harmonik rezonans gibi diğer titreşimsel konulardan kaynaklanır.

Tüm kör virologların çalıştığı şey; boncuklu görünümüyle, iki sporlu evredir. Virusler ortada bile yokken bulaşma yalanları uydururlar. Şekil değiştiren ve hareketlilik oluşturan Somatidlerdir. Modern tıp gerçekler ya da bilim üzerine kurulmamıştır ancak bunu değiştirmenin vakti geldi!  

—————————————————-

The New Biology

Yukarıdaki linkten bazı paragraflar;

Somatoskop, günümüzün faz kontrast mikroskobunun öncüsüydü. Canlı kanı ve sıvıları kimyasal boyama kullanmadan gözlemlemeye olanak sağlıyordu. Mikroskopiye olan bu yaklaşım; vücut sıvılarının sadece kimyasal profili üzerine değil, kanın ve hücrelerin fonksiyonelliği üzerine çalışmaya da imkan sağlıyordu.

Kronik hastalıkların çoğu konjenital ya da çevresel değildir. Yani anneden fetüse geçen bir doğum kusuru ya da çevreden vücudunuza giren bir patojen(mikrop) nedenli değildir.

Somatoskop canlı kan ve doku üzerine kimyasallarla boyamadan çalışılmasına olanak sağlayan ilk mikroskoptur. Yani çalışılan yapı, hala canlı olan dokudur. Sıradan mikroskoplar ve elektron mikroskopları ile bunu yapmak mümkün değildi.

Somatid, yeryüzündeki tüm organik hayatta faaliyet göstermektedir.

Genellikle canlı kan hücreleri örneklerini incelemek için kullanılan faz kontrast mikroskobu, Naessens’in somatoskopu oluşturma çabasından sonra meydana çıkmıştır. Bu mikroskoplar; bir tıp doktorunun, serum kan tahlillerinin bile ortaya çıkaramayacağı meseleleri anlamasını sağlamıştır.

Somatoskop, uygulayıcı ya da inceleyici tarafından incelenen örneği kimyasal boyamaya maruz bırakmadan çalışır. Bunun yerine kanı gözlemlemeyi mümkün kılacak şekilde renklendiren iki formda ışık kullanılır.       

Somatid, yeryüzündeki tüm canlılarda mevcuttur. Kuru toprakta, suyla aktive olmayı beklerler. Küçükken çürümenin basınç, sıcaklık ve hava ile alakalı olduğu öğretilmişti bize. Ne kadar da yanlış öğretilmiş. Tüm çürüme işleminin ardında somatidler vardır.

Somatid, 16 evreli bir döngüde, 16 değişken forma sahiptir. İlk üç form yalnızca biyolojik ortam sağlıklıysa vuku bulur. Fakat, biyolojik ortam, ideal verimlilikten daha kötü durumda işlev sergiliyorsa döngü diğer 13 evreye ilerler.  

1.video metni

 1. TANIM

– Gaston Naessens, somatid nedir?

– Somatid, yaşayan temel parçacıktır. Hayat için olmazsa olmazdır. Onu, hem hayvanlar hem de bitkiler aleminde görüyoruz. O olmadan hücresel bölünme gerçekleşemez.

Polimorfiktir(Birden fazla biçime dönüşebilen). Bir hücre kültüründe gelişmesini sağlayabildik ve bu şekilde iki döngüde polimorfik oluşunu gözlemledik. Önce küçük döngü gerçekleşiyor. Burada hücresel bölünmeye olanak sağlayan üreme hormonu oluşuyor. Bu döngü, kandaki inhibitörler(durdurucular) tarafından ve dejeneratifhastalıkların da dahil olduğu belli hastalıklar sırasında sonlandırılır. 3 aşamada gerçekleşen bu küçük döngü, devam ederek 16 aşamalı bir döngüye dönüşüyor. Tüm bunları size birazdan göstereceğiz.

Fakat sorunuzu cevaplayacak olursam; somatid, hayatın olmazsa olmaz bir unsurudur.

 

– Gözlemleriniz ne kadar geriye gidiyor?

– 1949’da hematolojide çalışırken kanda görülebilecek her şeyi görmediğim hissine kapılıyordum. Bir şeyin hareket ettiğini görüyor fakat ne olduğunu bilmiyordum. Ulaşabildiğim optik(görsel/ışıksal) yöntemler ihtiyacımı karşılamıyordu. Görebileceklerimi daha derinden araştırmak için daha iyisini yapmaya çalıştım.

İlk olarak optik meselesi üzerine yoğunlaştım. Almanya’ya gidip bana son derece yardımcı olan Alman zanaatkarlar ile çalıştım. Sonrasında bir ikileme düştük. Ya merceğin diyafram açıklığı ya da ışığın dalga boyu üzerine çalışabilirdik. Dünyanın tüm büyük optik firmaları sayısal açıklık konusunda çalışıyordu. Yani çok fazla seçeneğim yoktu. Işığın dalga boyu meselesine yoğunlaştım.

Bu şekilde gerçekten zahmete değer sonuçlar veren bir sistemi mükemmelleştirdim. Ve bu sistem sayesinde o meşhur parçacığı görmemizi sağlayan mikroskobu geliştirebildim. Yavaş yavaş onu gözlemleyebiliyordum ve kandan da ayrıştırdım. Onu izole edip bir kültürde geliştirebildim, bu şekilde polimorfik oluşunu saptadım.

 

– “Somatid ortobiyoloji” ile demek istediğiniz nedir?

– Ortobiyoloji kelimesinin bizzat etimolojisinin(köken bilgisi) işaret ettiği üzere; ortobiyoloji, somatid teorisine uyarlanmış ve uygun hale getirilmiş bir biyolojidir. Somatid teorisini anlamazsanız ortobiyolojiyi anlamanız imkansızdır. Fakat somatid teorisini anlamak için gözlemlerinizi yapacak uygun araçlarınız olmalı. Ve özellikle de somatoskopun temel prensibini anlamalısınız.

 

2. SOMATOSKOP

Herkes elektron mikroskobuna aşinadır. Herkes elektron mikroskobunun imkanlarını bilir. Elektron mikroskobu, 50 angstrom çözünürlükle 400bin kezden daha fazla büyütür. Elektron mikroskobuyla ölü doku, fikse/tesbit edilmiş doku üzerinde çalışabilirsiniz.

 

Somatoskop ileyse canlı hücreleri görebilir; gelişimlerini, polimorfik dönüşümlerini takip edebilirim. Somatoskobu, sıradan bir optik mikroskopla elektron mikroskobu arasında bir bağ olarak görüyorum. Bana göre, somatoskop bir boşluğu dolduruyor. O olmadan somatid teorisini anlamak çok zor olurdu.

Benden önce pek çok kişi de bu yönde çalıştı fakat bir şeyleri farklı yollardan farklı şekillerde gördüler. Ağırlıklı olarak kimyaya yoğunlaştılar. Bazıları optik üzerine de çalıştı, fakat inanılmaz karakterler de vardı. Birine “öğle vakti delisi” adını takmışlardı. Emile Doyen’di sanırım, 1911’lerdeydi. Plazmada canlı parçacıklar görebildiğini fakat onları sadece mayıs, haziran ve temmuzda öğle vakti 12’de gördüğünü söylüyordu. “Hareketi” gördü dolayısıyla kendisine deliymiş gibi muamele edildi. Fakat tam o vakitte güneş ışınlarının zirveye ulaştığını ve yoğun ultraviyole(morötesi) ışın içerdiğini hatırlarsak, bu durum tamamen farklı bir yöne gidiyor. Ultraviyole ışınları ve ışınlarının dalga boyları çok daha kısa olduğundan başka vakitlerde görülemeyen şeyleri görebiliyordu.

 Mantığımız çok benziyor bana göre, fakat sadece güneş ışığı kullanmak ve mayısta ya da haziranda öğle vaktini beklemek yerine, aynı koşulları ultraviyole ışınlar ve çeşitli mekanizmalar ile elektronik olarak oluşturabilirim. Işığın dalga boyunu azaltarak çözünürlüğü arttırabilir bu sayede de aksi durumlarda görünmeyen parçacıkları görebilirim.

Bu cihazın temel mantığı ışığın frekansındaki artıştır. 3.300 angstrom dalga boyuyla bir akkor ve 1.850 angstrom dalga boyuyla bir ultraviyole olmak üzere iki ışık kaynağı, üçüncü bir dalga boyu oluşturacak şekilde ışın verirler. Bu dalga, bir tek-renkli filtreden geçerek bir ışına dönüşür. Bu ışın, manyetik bir alana maruz kalarak Zeeman etkisi ile paralel çizgilere ayrılır. Bu paralel çizgilerden biri, frekansını yükselten Kerr hücresine girer. Çıplak gözle görülemeyen bu ışık kaynağı, çalışılacak olan örneği analiz eder.

 

Geleneksel kan inceleme yöntemi, yüz yıldan fazla bir süredir, kanın içerdiği elemanların boyar maddeye afinitesini(kimyasal ilgi) saptamak için kanı bir lam üzerine sürmek, fikse etmek ve boyamaktan ibarettir.

 

Solda, bu geleneksel yönteme göre hazırlanmış bir kan preparatı görüyoruz. Kırmızı kan hücrelerini, beyaz kan hücrelerini ve kan pulcuklarını belirleyebiliyoruz. Bu ölü bir kan. Sağda ise somatoskop ile kana bakıyoruz. Bu, vücuttan alındıktan sonra 10 dk içinde incelenen canlı bir kan. Kırmızı kan hücrelerini, beyaz kan hücrelerini, kan pulcuklarını ve fikse edilmiş preparatta göremediğimiz somatidleri görebiliriz.

Bir lenfosit mevcut. Kenarı ve çok sayıdaki somatidlerigörebilirsiniz. Kırmızı kan hücreleri tamamen normal. Burada bir monosit var. Monositin sitoplazmasında mevcut olan aktiviteyi ve çok sayıdaki somatidleri açık bir şekilde görebiliriz. Aşağı sol tarafta bir kan pulcuğu görüyoruz. Çok aktif bir monosit var burada. Bu büyütmede, sitoplazması ve sitoplazması içindeki hareketlilik çok açık bir şekilde görülebilir. Aynı zamanda çok sayıda somatid görüyoruz. Bu tarafta ise fagositik davranış gösteren çok-çekirdekli bir nötrofil var. Mevcut bulundukları zamanlarda hücre içi inklüzyonları veya somatid döngüsünün gelişmiş formlarını da görebiliriz.

_________________________

2. video metni;

Bu küçük döngü esnasında, hücre bölünmesi için zaruri olan bir büyüme hormonu oluşur. Bu durum, in vitro kültürlerde tekrar tekrar gözlemlendi. Eğer stres ya da herhangi bir biyolojik dengesizlik etkisi altında kandaki inhibitörler önemli oranda azalırsa; küçük somatid döngüsü, çok farklı ve polimorfik bir döngüye geçiş yapar. Böylece; toplamda 13 evre eklenecek şekilde, çeşitli aşamaların yer aldığı büyük döngünün oluşumunu görmeye başlarız.

 

Evre 4 – Bakteriyel Form

İlk olarak, inhibitörler azaldığında küçük döngünün normal bir ürünü olan bir bakteriyel formu görüyoruz. Bu endojen(iç kaynaklı) bakteriyel form, pek çok araştırmacı tarafından gözlemlendi. Almanya’dan Van Bramer(?) da ilk araştırmacılardan biridir.

 

Evre 5 – İkili Bakteriyel Form

Bir önceki bakteri formundan gelişen ikili bakteri formu, kan yaymasında genellikle gözlemlenir. Bu formun özelliği; kendisini, çubuklar oluşturacak şekilde, hücre bölünmesine benzer biçimde bölebilmesidir.

 

Evre 6 – Çubuk Formu

Çubuk formu, daha uzun olması ve sitoplazmasının boş gibi görünmesi dışında bakteriyel forma benzer.

 

Evre 7 – İki Sporlu Bakteriyel Form

Bu bakteriyel formun iki ucunda spor bulunduğuna dikkat edilmeli.

 

Evre 8 – Granüllü İki Sporlu Bakteriyel Form

Granüllü(tanecikli) iki sporlu bakteriyel form, hareket etmeye başlayan granülasyonlarla dolu bir sitoplazmaya sahiptir.

 

Evre 9 – Mikobakteriyel Form

Granüllü iki sporlu bakteriyel formun olgunlaşmış hali, mikrobiyologlar tarafından iyi bilinen mikobakteridir. Ayrıca, sitoplazması kendi kendine gelişmektedir.

Evre 10 – Kabarcıklı Mikobakteriyel Form

Az önce gördüğümüz mikobakteri, daha da gelişti ve kabarcıklı mikobakteri ismini almasına sebep olan kabarcık benzeri bölgeler oluşturdu.

 

Evre 11 – Patlama

Burada, kabarcıklı mikobakterinin patlamasıyla sitoplazmasındaki yapıların ortama salınmasını görüyoruz.

 

Evre 12 – Maya Benzeri Form

Kabarcıklı mikobakterinin patlamasının sonucu olan maya benzeri formlar, 4-5 mikron çapındadır. Bu aşamada dahi sentrozoma yönelik bulgular gösterirler.

 

Evre 13 – Askospor Formu

Maya benzeri formlar(yapılar), tomurcuklanarak/çoğalarak miselyal yapıların öncüleri olan askospor formları haline gelir.

 

Evre 14 – Erken Miselyal Form

Askospor/spor-kesesi formundan tallus(ana gövde) oluşumunu gözlemleyebiliriz. Bu durumda sitoplazma, erken miselyalformu meydana getirmek için yavaş yavaş şekil alır.

 

Evre 15 – Miselyal Form

Belli durumlar ve peristaltik hareketlerden sonra erken miselyal form, tallus benzeri bir sitoplazma geliştirir ve sonunda olgun miselyal form oluşur.

 

Evre 16 – Döngünün Sonu

Miselyal yapı tam olgunluğa eriştiğinde, sitoplazması son derece aktiftir. Ve patladığı zaman muazzam miktarda yeni parçacığı ortama salar. Her parçacık, tüm döngüyü baştan tekrarlayabilecek niteliktedir.

 

Fibröz Tallus (Atık)

Sitoplazmasını boşaltmış bir tallus, fibröz doku görünümündedir. Kan yaymalarında, somatid döngüsünden geriye kalan bu fibröz tallus rastlantısal olarak sıkça gözlemlenir ve boyama hatası olduğu düşünülerek önemsenmez. Şunu vurgulamak gerekir ki; miselyalözellikteki bu formlar, mantar gelişimi kriterlerinin hiçbirini karşılamıyor. Hatta çok yüksek dozlarda amfoterisinB, fungizone ya da herhangi başka bir antifungal maddeden etkilenmezler.

 

Edindiğimiz gözlemler sayesinde bir grup postulatta karar kıldık.

1. Somatid, polimorfik karakterdedir. Polimorfizm, kan inhibitörleri tarafından kontrol edilir.

2. Büyüme hormonları, somatid döngüsü sırasında üretilir.

3. Hem hayvanlar hem bitkiler aleminde, hücresel bölünme için somatid varlığı gereklidir.

4. Kan inhibitörleri yeterli olmadığında, büyüme hormonlarının hücresel metabolizmayı tehdit edecek seviyeye kadar artmasına izin verilir.

5. Tüm dejeneratif hastalıklar, bu bozuklukların bir sonucudur.

 

 

 

 

 

 

Spiral Anten Atlası Cildi ile İnsanın Frekanslarla İmtihanı

Spiral Anten Atlası Cildi ile İnsanın Frekanslarla İmtihanı

İsrailli fizikçiler 2003’ten bu yana insan cildine, yani en büyük organımıza yayılmış sayıları 2 ila 5 milyon arasında değişen ter bezi kanalları üzerine yayın yapıyor. Alanlarında en çok atıf alan çalışmalardan oluyor bunlar. İlgi neden mi büyük? Çünkü konu telekomünikasyon endüstrisi ve askeriyeyi yakından ilgilendiren 5G teknolojisi ile ilgili de ondan.

2008 – Human skin as arrays of helical antennas in the millimeter and submillimeter wave range
Yuri Feldman 1, Alexander Puzenko, Paul Ben Ishai, Andreas Caduff, Aharon J Agranat
https://pubmed.ncbi.nlm.nih.gov/18517913/

2009 – The electromagnetic response of human skin in the millimetre and submillimetre wave range
Yuri Feldman 1, Alexander Puzenko, Paul Ben Ishai, Andreas Caduff, Issak Davidovich, Fadi Sakran, Aharon J Agranat
https://pubmed.ncbi.nlm.nih.gov/19430110/

2011 – The remote sensing of mental stress from the electromagnetic reflection coefficient of human skin in the sub-THz range
Eli Safrai 1, Paul Ben Ishai, Andreas Caduff, Alexander Puzenko, Alexander Polsman, Aharon J Agranat, Yuri Feldman
https://pubmed.ncbi.nlm.nih.gov/22170380/

2014 – Circular polarization induced by the three-dimensional chiral structure of human sweat ducts
Itai Hayut 1, Paul Ben Ishai 1, Aharon J Agranat 1, Yuri Feldman 1
https://pubmed.ncbi.nlm.nih.gov/24827286/

Ta 1948’lerde “The Book of Antennas” diye ders kitaplarında konu anlatımı yapılan en temel anten tipi işe bakın ki bizzat cildimizde çıkıyor, hem de milyonlarcasıyla!

Antenler, boşlukta yayılan elektromanyetik dalgaları toplayarak iletim kanalı içerisinde yayılmayı sağlamak (receiver) ya da boşluğa elektromanyetik dalgalar yaymak (transmitter) amacıyla tasarlanmışlardır. Antenler, verileri yaydıkları dalgalar itibariyle kilometrelerce uzaklara taşıyabilirler. Bir antenin gönderme ve alma özellikleri aynıdır. Buna antenlerin karşılıklılık (reciprocity) özelliği denir. KAYNAK
Ter bezlerimizdeki spiral kanallar

İbrani Üniversitesi’nden fizik profesörü Ben-Ishai’nin dediğine göre, “bu dalga boylarına [5G frekanslarını kastediyor] maruziyette ciltteki bu sarmal yapıdaki kanallar aktif anten tarlasına dönüşüyor”. Yani vücudumuz daha iletken hale gelmiş oluyor.

2014’teki çalışmaları ile, sarmal yapıdaki ter kanallarımızın, yani anten tarlamızın dışarıya dairesel polarize dalgalar yaydığını ve bunun iki yönlü (sağ-sol) olduğunu keşfediyorlar.

Fiziksel eforda nasıl terliyorsak mental ve duygusal stres altındayken de terliyoruz. Yani sempatik sinir sistemimiz devreye giriyor. Ciltteki ter kanallarının sinirlerle bağlantısı önemli, çünkü askeriyenin de kalabalık (örn. gösterici grubu) dağıtmak için kullandığı ve “ölümcül olmayan silah” kategorisinde yer alan milimetrelik dalga boylarındaki ışın tabancalarına maruziyette cildimizin ateşe verilmiş gibi yanması üzerine sıçrayarak ışından kaçma refleksi göstermemizin nedeni de sinirlerle olan bu bağlantı. Yani iddia edildiğinin aksine, dışarıdan maruz kaldığımız bu çok yüksek frekanstaki dalgalar cilt yüzeyinde kalmıyor, fiziksel ve biyolojik olarak bizi etkiliyor. Bunun mekanizmasını da, ciltteki bu “sarmal anten tarlası”nın keşfi ile anlayabilmiş oluyoruz.

İşin ilginç yanı, tıpkı alıcı-verici görevi gören anten gibi bizim bu sarmal ter kanallarımız vasıtasıyla enerji iletimi salt dışarıdan içeriye doğru değil, aynı zamanda içeriden dışarıya doğru da gerçekleşiyor. Vücut iç sıcaklığı yükseldiğinde (diyelim spor yaptık yahut ateşlendik), ısının içten dışa bu sarmal kanallardan geçerken filtrasyonu ve dışarı dairesel salınımlarla verilmesi sözkonusu.

Yani ciltten hem enerji soğuruyor hem de veriyoruz.

Milimetre ve milimetre altı dalga boylarının biyolojik etkileri olduğunun ortaya çıkması, hem de dünya genelinde farklı gruplarca tekrarlı deneylerle bilimsel olarak kanıtlanmış bulunması endüstri tarafından -Prof. Ben-Ishai’nin tabiriyle- hiç ama hiç hoş karşılanmıyor. İmplikasyonlar çok yönlü çünkü; en basidinden akla doğabilecek türlü cilt hastalıkları, kanser ve elbette ağrı sendromları geliyor. Bunun yanısıra, sinir sistemi ile olan etkileşimde dolayı oluşabilecek korku, anksiyete, depresyon gibi duygu durumlarının yanısıra çeşitli nörolojik rahatsızlıklar elbette akla geliyor.

Bu bir askeri teknoloji ve silah olarak kullanılıyor

ABD, Rusya ve Çin’in savunma bakanlıkları uzun yıllardır 5G’nin sahip olduğu elektromanyetik frekans aralığını kalabalık grupların dağıtılmasında silah olarak kullanıyor. Active Denial Systems denilen bu ışın silahları üzerine doğrultulduğu kişilerin cildinde yanma hissi yaratıyor. Görünmez silahla, iz bırakmadan can yakabiliyorsunuz.

İsrailli araştırma grubunun konuyla ilgili 2016’daki çıkarımları şöyle:

  • Halkın subTerahertz frekans aralığındaki milimetrelik dalga boylarına maruziyeti arttıkça en başta bebekler, gebeler, ileri yaş grubundakiler, hastalar ve elektromanyetik dalgalara aşırı hassasiyeti olanlar bundan olumsuz etkilenecektir.
  • Ciltteki ter kanallarını besleyen sempatik sinir sistem sayesinde insanlar duygu durumlarını bu kanallardan dışarı yaydıkları elektromanyetik dalgalarla yansıtmakta ve aynı şekilde dışarıdan gelen elektromanyetik dalgaları da soğurmaktadır.
  • İnsan ter kanallarının bu yeni tarif edilen fizyolojik ve psikolojik fonksiyonları ne nörofizyologlar ne de psikologlar tarafından çalışılmış değildir.
  • Bilgisayar simülasyonları ter bezlerinin subterahertz (milimetrelik) dalgaları ciltte yoğunlaştırdığını göstermektedir. İnsanlar bu dalgaları sıcaklık şeklinde hissedebilmektedir. Bu dalga boylarını kullanan haberleşme teknolojileri (cep telefonları, wi-fi, antenler) yüzünden insanlar ağrı reseptörleri (nosisptör) vasıtasıyla fiziksel olarak acı ve ağrı duyabilirler.
  • 5G WI FI kullanımı daha fazla yaygınlaştığı takdirde şu anda RF (radyofrekans) / mikrodalga frekansları yüzünden görülen sağlık sorunları ve elektriğe aşırı hassasiyet durumu muhtemelen daha da ağırlaşıp yaygınlaşacak ve belki de henüz bilinmeyen nörolojik problemler ve fiziksel olarak duyulan ağrı ile ilgili şikayetler ortaya çıkacaktır.
  • 5G teknolojisi ile sözkonusu sağlık sorunları arasındaki bağlantının bilimsel bakımdan ispatı mümkün olduğundan, halka tazminat yolu da açılmış olacaktır.

Yazımıza aynı ekipten Prof. Yuri Feldman’ın geçtiğimiz sene İsrail’de düzenlenen ‘2020 Uzmanlar Toplantısı: Kablosuz İnternet & Cep Telefonu Radyasyonu ve Kamu Politikaları’ toplantısındaki sunumunu kapattığı cümleler ile son verelim:

“Peki o zaman 5G zararlı mı değil mi? Valla sağlam alıcı görevi gören bir donanımımız var ve merkezi sinir sistemimizin bu etkiye vereceği yanıt hakkında da fikrimiz yok. Ya hep beraber dahi olup çıkacağız ya da zombi.”

Thomas Cowan-Virüsler, bulaşıcılık ve 5g üzerine..

Thomas Cowan-Virüsler, bulaşıcılık ve 5g üzerine..

Ezber bozan bir kitap olan, amazonda satışı yasaklanan Contagion Myth / Bulaş Efsanesi kitabı yazarı Dr.Thomas Cowan’ın aynı kitabının giriş kısmında bahsettiği videosudur. Konuşma 12 Mart 2020’de yapılmıştır.

Harika konuşmasının dökümü şu şekildedir:

En büyük pan.demi olan 1918 İspanyol gr!bi pan.demisinden sonra Steiner’a tüm bunların neyle ilgili olduğu sorulduğunda şöyle cevap verdi;  
V!rüsler, toksik bir hücrenin atıklarıdır sadece. Virüsler, bazı başka proteinlerle birlikte DNA ya da RNA parçalarıdır, hücreden tomurcuklanarak ayrılırlar.. Hücre zehirlendiği zaman oluşurlar. Hiçbir şeyin nedeni değildirler.

Sizi bu konuda düşünmeye teşvik edeceğim ilk yol şöyle olur;

..farz edin ki bir yunus doktorusunuz, kuzey kutup dairesindeki yunuslar üzerinde çok uzun bir süredir çalışıyorsunuz, ve yunuslar da gayet sağlıklılar. Fakat bir gün sizi arayıp   “Fred, kuzey kutup dairesindeki tüm yunuslar ya da yunusların çoğu ölüyor, gelip araştırabilir misin?”   diyorlar. Ve bir soru sorma hakkınız var.   Oylama yapalım. Kaçınız “Genetik yapısını görmek için bir yunus incelemek istiyorum.” derdi? Hiç kimse. Çünkü bu aptalca.   Kaçınız “Şu ve bu yunusda v!rüs var mı diye incelemek istiyorum çünkü tüm yunusların hastalanma nedeni bulaşıcı bir hastalık olabilir.” derdi? Bu arkadaş. Kaçınız -fransızcamı bağışlayın- “Biri bu suya bi halt mı koydu?” derdi Exxon Valdez kazası gibi. Kimse var mı böyle düşünen? Herkes.   Çünkü olan buydu.   Hücreler zehirlendikleri zaman bizim v!rüs olarak adlandırdığımız atıkları/döküntüleri boşaltarak kendilerini temizlemeye çalışırlar. Eğer NHI(Ulusal Sağlık Enstitüleri) başkanının v!rüslerin karmaşıklığı hakkında yaptığı son konuşmalarından birinde geçen, v!rüslerin eksozom olarak adlandırıldığı güncel teoriye bakarsanız, ..bunun v!rüsün ne olduğu ile ilgili mevcut düşünceye kusursuz bir biçimde uyduğunu görürsünüz.   Bununla ilgili dramatik bir örneğim var:   Ben büyürken evimizin hemen dışında sulak bir arazi vardı. Kurbağalarla doluydu ve geceleri beni uyutmazlardı bu yüzden pencereleri bantlardım, ilkbaharda epey şamata yaparlardı. Fakat zamanla kurbağalar tamamen yok oldu. Kaçınız kurbağaların genetik bir hastalığı olduğunu düşünüyor? Kaçınız kurbağaların bir v!rüse yakalandığını düşünüyor? Kaçınız birisinin suya DDT koyduğunu düşünüyor? Olan buydu.   Hastalıklar zehirlenmedir. Bu, a$ıların neden olduğu.. bunu birazdan anlatayım..  

Peki 1918’de ne oldu?

Son 150 yılda, her pan.demide yeryüzünün elektrifikasyonunda önemli bir atılım vardı. 1918’de, 1917’nin sonbaharının sonlarına doğru, dünya genelinde radyo dalgalarının tanıtımı yapıldı.   Ne zaman herhangi bir biyolojik sistemi yeni bir elektromagnetik alana maruz bırakırsanız. ..onu zehirlersiniz, bazılarını öldürürsünüz ve geri kalanı bir nevi (suspended animation) komaya/kriyojenik uykuya geçer. İlginç bir şekilde biraz daha uzun ama daha hasta olarak yaşarlar.   Sonrasında 2. Dünya Savaşı’nda radar ekipmanlarının tüm dünyaya tanıtımıyla yeni pan.demi başlar. İnsanlık, tüm yeryüzünün radar alanlarıyla örtülmesine ilk defa maruz kaldı. 1968’de Hong Kong gr!bi vardı, bu aynı zamanda Van Allen Kuşağı içerisinde ilk defa dünyanın koruyucu bir tabakasının oluşturulduğu vakitti. Van Allen Kuşağı, esasen güneşten, aydan, jüpiterden vb gelen kozmik alanları bütünleştirerek yeryüzündeki canlılara dağıtır. Ve biz Van Allen Kuşağına radyoaktif frekanslar yayan uydular yerleştirdiğimizde, 6 ay içinde yeni bir v!ral pan.demimiz oluyor. Neden v!ral? Çünkü bireyler zehirlenmiş durumdalar, toksin atıyorlar, bunlar v!rüs gibi görünüyor, insanlar bunun bir gr!p salgını olduğunu düşünüyor.   1918’de Bostan Sağlık Departmanı bunun bulaşıcılığını test etmeye karar verdi. Sonrasında ister inanın ister inanmayın, gr!pli yüzlerce hastanın burnundan sümük çekip gr!p olmayan sağlıklı insanlara enjekte ettiler. Ve bir kere bile karşı taraftaki bireyi hasta edemediler. Bunu tekrar tekrar yapmalarına rağmen bulaşmayı gösteremediler. Görünüşe göre İspanyol gr!bi olan atlarla bile yaptılar bunu. Kafalarına torba geçirip at torbaya hapşırdığı zaman torbayı öteki atın kafasına geçirdiler. Ve tek bir at bile hastalanmadı.   Bunu Art.hur First.enberg’in !nvisible Rainbow/Görünmez Gökkuşağı kitabında okuyabilirsiniz. Kendisi yeryüzünün elektrifikasyonundaki tüm aşamaların ve 6 ay içinde dünya genelinde nasıl yeni bir gr!p pan.demisi oluştuğunun kroniğini çıkarmıştır. Normal açıklamaları duyduğunuzda.. Kansas’tan(ABD) Güney Afrikaya 2 haftada nasıl gitti.. ..yani ulaşım at sırtında ve botlarla sağlanmasına rağmen nasıl oldu da tüm dünya semptomları aynı anda gösterdi.. Bunun hiçbir açıklaması yok, sadece “nasıl olduğunu bilmiyoruz” diyorlar. Fakat bazılarınızın cebinde ve bileğinde olan radyo dalgalarını ve diğer frekansları işin içine katarak düşündüğünüzde, Japonya’ya bir sinyal yollayabilirsiniz ve anında varır. Yani aranızda, dünya çapında saniyeler içinde iletişimi sağlayan bir elektromanyetik alan olduğuna inanmayan varsa sadece olaya dikkatini vermiyor demektir. Yeryüzünün elektrifikasyonunda son 6 ayda dramatik ve önemli bir atılım olduğunu belirteyim.   Ve eminim ki çoğunuz bunun ne olduğunu biliyor; be.şG. Şu anda 20bin radyasyon yayan uydu mevcut, tıpkı cebinizdeki ve bileğinizdeki radyasyon yayan ve sürekli kullandığınız cihaz gibi, ki bu sağlığımız için uygun değil.   Bunu söylediğim için üzgünüm fakat, bu sağlığımız için uygun değil.

Okumaya Devam Et

Kanadalı Doktorlar Konuşuyor / Video

Kanada Sağlık Birliği adına halkı bilgilendirmek amacıyla çekilmiş video metnidir: Covid'den Korkmamıza Gerek Yok; İşte Başlıca GerekçelerKanadalı...

Tıpta Dolandırıcılık ve Hile: Virüs Nerede?

Tıpta Dolandırıcılık ve Hile: Virüs Nerede?

“1 devir olmuş 10 olmuş 40 olmuş, hiç mühim değil. PCR testinde devir sayısının da bir anlamı yok, zira ortada virüsün mevcudiyetine dair kanıt yok!” – Prof. Dr. Stefano Scoglio 

Evet, bu defa İspanya’dayız ve Amerika Birleşik Devletleri’nden Dr. Andrew Kaufman ile İtalya’dan Prof. Scoglio’nun farklı kulvarlardan gidip aynı sonuca ulaştıkları konuda, bu uzmanların görüş ve açıklamalarını teyit eder nitelikteki bulgularıyla söz Prof. Jesús García Blanca’da.

Hilekarlık Artık İspatlı: PCR, SARS-CoV-2 tespitine yaramıyor

242. Sayı – Kasım 2020

Covid-19’a atfedilen hastalık ve ölümlere yol açtığından şüphelenilen SARS-Cov-2’yi tespit için kullanılan PCR’lardaki gen dizilimleri, bizzat insan genomundaki düzinelerce dizilimle eşleştiği gibi, yüze yakın mikropta da bulunuyor. Ve bunlara primerler, yani taşıdıkları iddia edilen “genom”dan rastgele alınmış geniş bölümler ile “hedef genler” denilen ve bu “yeni koronavirüs”e özel olduğu iddia edilen dizilimler de dahil. Testin hiçbir hükmü yok ve bugüne kadar çıkan “pozitif”lerin mutlaka bilimsel bakımdan geçersiz ilan edilerek testi alanlara durumun iletilmesi, hayatını kaybetmiş olanların da ailelerine bu bildirimin yapılması gerekir. Zira dünyanın PCR konusunda en önde gelen isimlerinden Stephen Bustin bile, uygun koşullarda PCR ile sonucu pozitif çıkmayacak kimsenin olmadığını ifade ediyor!

Mart’tan bu yana sizleri uyarıyoruz: sizde var mı yok mu anlamak için baktığınız virüsün bileşenleri nedir, neye benzemektedir bilmeden, buna özel test filan geliştiremezsiniz. Virüsün bileşenlerinin neye benzediğini de o virüsü bulup, diğer her şeyden ayrı olarak tek başına ortaya koymadan (saflaştırma/izolasyon) bilebilmenizin imkanı yok. Biz de bu süreçte SARS-CoV-2 denilen virüsün kimse tarafından izole edilmemiş olduğuna ve hatta geçtiğimiz haftaki sayımızda açıkladığımız nedenlerden dolayı böyle bir şeyin (virüs izolasyonu) mümkün de olmadığına dair kanıtları biriktirmeye devam ediyoruz. (Lütfen –www.dsalud.com- sitesinden “Patojenik virüs diye bir şey olduğunu ispat edebilir misiniz?” başlıklı yazımızı okuyunuz). 

Bu raporda da RT-PCR testinin, SARS-CoV-2 denilen şeyi değil, insana ait RNA parçacıkları ile çok sayıda mikropça da taşınmakta olan RNA fragmanlarını bulmakta olduğuna dair yeni verileri sunuyoruz. RT-PCR’ın çok sayıda kurum/kuruluş, WHO ya da CDC gibi resmi ve idari birimler ve dünyada otorite olarak kabul edilen Dr. Stephen Bustin gibi uzmanlarca da kabul edilen türlü problemlerine değinmiş, Bustin’in, çıkan sonuçların yorumlanmasında kullanılacak kriter seçimindeki rastgeleliği de, cihaza yaptırılacak devir sayısı seçimini de tamamen saçma olarak nitelendirdiğinden, çünkü bu şekilde kimi test ederseniz edin pozitif çıkma ihtimali doğurduğundan bahsetmiştik. Bu raporla da, var olduğu iddia edilen SARS-CoV-2 virüsü ve WHO’nun RT-PCR kullanımına dair yönerge ve protokolleri üzerine yapılmış özel bir araştırmanın sonuçlarının yanısıra, geri kalan tüm “insan koronavirüsleri” için toplanmış verileri de sizlerle paylaşmak istiyoruz.

İnsan koronavirüsü” olarak kayda geçen virüslerin yedisinin de izolasyonu gerçekleştirilmemiş!

Araştırmalarımız sonucu ortaya çıkan bulgu ise fazlasıyla ciddi: “İnsan koronavirüsü” olarak kayda geçen virüslerin yedisinin de izolasyonu gerçekleştirilmemiş ve bunları tetkik için kullanılan PCR’lerdeki primerlerin gen dizilimlerinin tamamı ile, virüs genomuna ait diye sunulan genetik fragmanların büyük kısmı bizzat insan genomunun farklı yerlerinde bulunan, ayrıca isimlerini vereceğimiz şu bakteri ve arkelerin genomunda da mevcut olan dizilimler çıkmıştır: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis ve daha niceleri. Bizi bu umulmadık sonuca götüren araştırmayı şimdi sizlere adım adım açıklayacağız.

Koronavirüslerinin herhangi bir tanesi izole edilmiş mi?

Nisan ayının birinci yarısında gerçekleştirdiğimiz ilk incelemede SARS-CoV-2’nin izole edilmemiş olduğunu fark edip, izolasyon yaptıklarını öne sürenlerin ise bunu önceki “insan koronavirüsleri”ne ait “izolat”lara dayanarak ileri sürmekte olduklarını görünce, bahsi geçen bu önceki virüs izolatlarına ait literatürü, iddiaların doğruluğunu sınamak için mercek altına almaya karar verdik. İncelediğimiz insan koronavirüsleri şunlar: 229E (1965’te izole edilmiş olduğu öne sürülmekte), OC43 (1967), SARS-CoV (2003), NL63 (2004), HKU1 (2005) ve MERSCoV (2012). Elde ettiğimiz sonuçlar ise şu şekilde:

Koronavirüs 229E. 

Referans yayın: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1: 190-193. January 1, 1966. 

Bu yazarlar, kullanmış oldukları ‘Kompleman Fiksasyonu’* denilen izolasyon metodundan bahsederken başka yayınlara atıfta bulunmuş olduklarından, metodu anlamak için verdikleri atıflardan birine baktık: Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5): 931-938, May 1965. Antijen-antikor reaksiyonundan hareketle bu ikiliden herhangi birini tespite yarayan, ancak tedavülden kalkmış bir prosedür bu. Burada, yeni virüs olarak lanse edilen yapının antijenleri aranıyor, ancak daha önce de açıkladığımız gibi, bunun için denklemde bulunması gereken virüse-özel antikorlar virüsle ilk defa karşılaşılıyorsa zaten ortada yoktur. 

*Kompleman Fiksasyonu: İng. Complement Fixation. Antijen ve antikorun karşılıklı etkileşimi ile komplemanın aktive oluşu ve antijen-antikor kompleksine bağlanışı; kompleman bağlanması; kompleman tespiti

Koronavirüs OC43. 

Referans yayın: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub. 

Bu yayında, kültürlerden alınıp virüs RNA’sıdır diye ortaya konmuş yapının virüsten geldiğini gösterir hiçbir kanıt bulunmamakta. Deneyde kullanılan QIAamp kiti adlı cihaz miyarları**, inhibitörleri ve kirleticileri temizliyor temizlemesine, ancak yapamadığı şey, çıkan RNA’nın nereden geldiğini belirlemek. Ve deneyde kontrol düzeneği de kullanılmamış. Ardından ise PCR ile büyültülüp, virüs genetik bilgisi olduğu varsayımı (!) ile dizilimi ortaya konmuş. Ve yayın yazarın, mevzubahis şey bir “virüs”müş gibi, bu intibaı verecek şekilde (halbuki tamamen ispatsız) mutasyonlardan, yeniden kombinasyonlara gitmelerden, genotiplerden, moleküler evolüsyondan, suşlardan ve viroloji jargonu içeren diğer şeylerden bahisle yaptığı spekülasyonlar ile son buluyor.  

**Miyar: İng. Reagent. Bir maddenin varlığını ya da niteliğini belirleme amacıyla çözeltiye ilave edilen madde; miyar; ayıraç

SARS-CoV Koronavirüsü.

Referans yayın: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

Yayında pürifikasyonun sözü edilmiyor. Filtrasyon veya santrifüjlemenin bahsi dahi geçmiyor. Söylenen tek şey virüslerin, iki hastaya ait nazofarengeal aspiratlar ile akciğer biyopsilerinin yavru maymundan alınmış karaciğer hücrelerinde oluşturmuş kültürden izole edilmiş olduğu. Kontrol olarak kullanılan herhangi bir düzenek yine yok. Bir tek bir “sitopatik etki”den [hücre yapısında değişiklik, bozulma] bahsediliyor, o da virüse atfediliyor, varlığı bilinen virüs ve retrovirüslere PCR ile baktık ve bir sonuç elde edemedik deniyor. En sonunda bir RT-PCR’a girişiliyor, bunda da “rasgele seçilmiş inisiyatörler” [başlatıcılar] kullanılıyor ve “kaynağı bilinmeyen” [neye ait olduğu, nereden geldiği belli olmayan] bir gen dizilimi saptanıyor. Bununla ilgili olarak da, “koronavirüs ailesi ile zayıf bir homoloji” [benzeşme] tespit ediliyor. Sonra bu gen dizilimi için primerler hazırlıyorlar ve test etitkleri 44 SARS hastasından yalnız 22’si pozitif çıkıyor.

Koronavirüs NL63. 

Referans yayın: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004. 

Yazarlar şöyle diyor: “Kimliği bilinmeyen patojenlerin neye ait olduğunu moleküler biyoloji gereçleri ile bulmak zor, zira hedef dizilimin ne olduğu bilinmediğinden PCR’ye özel inisiyatörler  de [başlatıcılar] hazırlanamıyor.”

Burada VIDISCA adlı kendi geliştirmiş oldukları ve dizilimin ne olduğunu bilmeye gerek bırakmadığını iddia ettikleri bir gereç kullanmışlar! Böyle bir şey mümkün olabilir mi? Yapılan şey tam olarak nedir, bir bakalım: Önce kültür hazırlanıyor ve görülen “sitopatik etki”ye dayanılarak ortamda virüs olduğuna kanaat getiriliyor. Bu metodun getirdiği yenilik şu; nükleik asit moleküllerini mutlaka aynı uzunlukta olacak şekilde belirli yerlerinden kesen ve ismine “kısıtlama enzimleri” [restriction enzymes] denilen bir tür enzim kullanıyorlar. Bu enzimlere maruz bırakıldıktan sonra ortaya çok sayıda aynı veya oldukça benzeşen DNA veya RNA bölümleri çıkıyorsa, o zaman bu virüsten gelmiştir diyorlar. Burada da, canlı konağın genomu olsa birbirine benzemeyen dizilimde fragmanların ortaya çıkması lazım ama virüs öyle değil, virüs kendini kopyalayarak çoğaldığından birbirinin aynı dizilim parçaları görülüyorsa, bu olsa olsa virüs kaynaklıdır mantığı güdüyorlar. Peki ama bu çıkarım doğru mu? Elbette değil! Bu varsayım (ki ortada bir virüs olduğu varsayımının üzerine yapılmış ikinci varsayımdır bu), “virüs benzeri partiküller”, “retrovirüs benzeri partiküller”, “endojen retrovirüsler”, “eksozomlar”, “vücut hücrelerinin dışında kalan alanlardaki” partiküller ve hatta mitokondriyel DNA mevcudiyetini hiç hesaba katmamakta. “Virüs”lerle aynı kapasitede üreme özelliği gösteren dünya kadar partikül bulunmakta ve bunlar enzimle kesildikten sonra ortaya çıkarmış oldukları birbirinin aynı kopyalarla testte yanıltıcı sonuç çıkmasına neden olabilir. VIDISCA’da kullanılan teknikle ilgili kaleme alınmış “Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery” başlıklı makalede de bahsini ettiğimiz bu açık ele alınmaktadır. Virus Research (Virüs Araştırmaları) dergisinin 2 Nisan 2019 tarihli 263. sayısında Cormac M. Kinsella et al. tarafından kaleme alınmış makalede geçen şu ifadeyle de bu gerçek kabul edilmektedir: “VIDISCA insert’ünde konağın sağladığı arkaplan nükleik asitten fazlası, ‘virüs benzeri’ karakteristikleri olması (yani mitokondriyel DNA’da olduğu gibi fazla sayıda kopya üretebilme yeteneği) haricinde, beklememektedir.”

Koronavirüs HKU1. 

Referans yayın: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005. 

İnanılır gibi değil ama makale şu sözlerle açılıyor: “Solunum yolları enfeksiyonlarından mustarip hastalar üzerinde bugüne kadar yürütülmüş yoğun ve detaylı araştırmalara rağmen, hastaların önemli bir bölümünde mikrobiyolojik bir nedene rastlanmamıştır. RNA, saf hale getirilmemiş kültürlerden çıkarılmaktadır.” Ve burada da koronavirüs genlerinin bulunduğu bir PCR kullanılıyor. Sekanslama (gen diziliminin oluşturulması) için familya, domain, fonksiyonel yerleşkelere göre düzenlenmiş iki protein veritabanı -PFAM and INterProScan- ile birlikte, nükleotidlerin nasıl birleşmesi gerektiği üzerine “tahmin” yürütmede kullanılan iki de bilgisayar programından yararlanılıyor. Yayında şu ifadeler de geçiyor: “Genler tarafımızdan manuel olarak bir araya getirilip sekanlanslanmış olup, ardından da virüs genomuna ait dizilime son halini vermek üzere düzeltme yapılmıştır [editing].” Ve bu çalışmada da herhangi bir kontrol düzeneği görmüyoruz.  

MERS-CoV Coronavirus. 

Referans yayın: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012. 

Genetik materyal, High Puré Viral Nucleic Acid Kit adlı bir gereçle doğrudan kültür üst fazı ve balgam numunesinden ekstrakte edilip ardından da farklı PCR’larla, bilinen türlü mikroorganizmalarla eşleşiyor mu diye bakılıyor. Pürifikasyon yapıldığına dair bir bildirim göremiyoruz yayında ve kontrol düzeneği yine yok

Kısacası, daha ilk koronavirüslerden itibaren (ve “virüs” olduğu öne sürülen diğer diğer pekçoğu için de) yapılmış olan şey şu: Enfekte olduğu varsayılan (her ne “sitopatik etki” gözlemleniyorsa bunun bir tek virüs mevcudiyetine bağlı oluşabileceği varsayılıyor) dokular kültürlenip ya buradan birtakım proteinler elde ediliyor ve hiçbir teste filan tabi tutulmadan “virüs antijenleri” ilan ediliyorlar ve sonra bu “antijenler” olur da doku kültürlerinde de çıkarsa [burada tespit edilirse] bunu da “izolasyon”dan sayıyorlar veyahut da, virüse ait olduğu önkabulüyle kültürden birtakım nükleik asit fragmanları çıkarılıyor [ekstraksiyon].    

Bir önceki sayıda yer verdiğimiz makaleden hatırlayacağınız gibi, Dr. Stefan Lanka’ya göre bu “sitopatik etki” denilen şey esasında bizzat kültürün içine sokulduğu koşullardan kaynaklanmakta. Bu durum, Andrea Németh ve arkadaşlarının 15 Ağustos 2017 tarihinde Nature dergisinde yayına giren Antibiyotik uygulamasına bağlı olarak açığa çıkan, yüzeyle ilintili DNA’ya sahip küçük ekstraselüler [hücredışı] veziküller (eksozomlar) başlıklı yayınlarında da tanımlanmış durumda.  

Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf)

Burada açıklandığına göre, laboratuvar deneyi [in-vitro deney] yapılırken hücre kültürüne dışarıdan eklenen bazı maddeler, örneğin antibiyotikler, oluşturduğu stresle daha önce kültürde varlığı saptanmayan yeni birtakım gen dizilimlerinin ortaya çıkmasına neden olabilmekte. Bu durumun, 1983’te Nobel ödülünü kabul konuşmasında bizzat Dr. Barbara McClintock tarafından da dile getirilmiş olduğunu hatırlatalım. 

https://www.nobelprize.org/uploads/2018/06/mcclintocklecture.pdf

İşin özü şu ki, İNSANA AİT KORONAVİRÜS OLARAK ADDEDİLEN YEDİ VİRÜS DE GERÇEKTE İZOLE EDİLMEMİŞTİR. Birbirlerinden tek farkları kullanılan laboratuvar prosedür ve teknikleridir, ki bunlar da gitgide daha sofistike hale gelmiş, ancak bu sofistikasyon daha doğru sonuçlar elde etmek olarak değil, kanma ve kandırmacaya daha müsait bir zemin oluşturma olarak tezahür etmiş, bu durum SARS-CoV-2 diye bir şeyin kağıt üzerinde yoktan var edilmesi, resmen icat edilmesi ile doruk noktasına ulaşmıştır. 

Böyle bir virüs izole filan edilmemişse, buradan çıkacak sonuç bittabii ki bu tür “koronavirüsler”in herhangi bir hastalığın sorumlusu olarak gösterilemeyeceğidir. Dahası, bahsi geçen “virüsler”e ait olduğu öne sürülen yapı ve bölümler (nükleik asitler veya proteinler) üzerinden düzenlenmiş her ne tür test düzeneği olursa olsun hiçbir şekilde ne “enfeksiyon testi” olma vasfına ne de “tanı testi” olma hükmüne sahiptirler.

YANITSIZ KALAN SORULARA YENİLERİ EKLENİYOR 

Önceki sayıda, SARS-CoV-2 “virüs”ünü izole ettiklerinden bahseden bilimsel yayınların yazarlarına yöneltilmiş sorulara gelen yanıtların derlemesini sunmuştuk. Bu yazarlar virüs için “saflaştırma” prosesinin yapılmamış olduğunu kabul ve ikrarla, esasen virüsün izole de edilmemiş olduğunu kabul etmiş oldular. Ve şimdi bu kanıtlara bir yenisini daha ekliyoruz: Farklı ülkelerin resmi yetkililerince (siyasi idare ve sağlık bakanlıkları nezdinde) SARS-CoV-2 izolasyonu ve pürifikasyonuna [saflaştırma] dair sorgulamalara verilmiş yanıtlar.  

James McCumiskey’den –Son Tezgah: Biyomedikal Paradigma (The Latest Conspiracy: The Biomedical Paradigm) kitabının yazarı- öğrendiğimize göre, İrlanda Milli Virüs Referans Laboratuvarı konuyla ilgili Dublin Üniversitesi‘nden bilgi istiyor, üniversite ise “talebe cevaben verebilecekleri bir kaydın bulunmadığı” yanıtını veriyor. Laboratuvarın hukuki hizmetler birimi direktörü ısrarcı olunca üniversitenin yanıtı şu oluyor: “Üniversite olarak, akademik konuların Bilgi Edinme Hakkı Kanunu gereğince sorgulamaya tabi tutulamayacağı görüşündeyiz.” Milli Virüs Referans Laboratuvarı’nın yapmış olduğu bilgi talebinden şunu anlıyoruz ki, üniversite SARS-CoV-2’yi izole etmiş ve buradan kültürlemeye gitmiş değil. Kabul ve ifade ettikleri tek durum, “diagnostik numunelerde SARS-CoV-2 RNA’sı saptanmış” olması.  

22 Haziran’da bir grup uzman benzer bir sorgulamayı doğrudan İngiltere başbakanı Boris Johnson‘a yapmıştı. Mektupta imzası olanlardan Dr. Kevin Corbett (Imperial College’da akademisyen) ve Piers Corbyn (mühendis, bağımsız araştırmacı) ile o dönemde yaptığımız söyleşiyi de yayımlamıştık. Bunun dışındaki imza sahipleri ise David Crowe, Dr. Andrew Kaufman, Edinburgh’da biyoloji profesörü Roger Watson ile kimyager David Rasnick idi. Bu isimler ortak sorgularına hala bir yanıt alabilmiş değiller! 

Benzer bir başka sorgu, bu defa Kanada’nın Milli Araştırmalar Konseyi’ne yapışmış ve aldıkları cevap şu: “MAK’deki kayıtlar bütünüyle incelenememiş olduğundan üzülerek bildirmek istiyoruz ki, talebinize cevap olabilecek yayın bulunamamıştır.

Buna Kanada, Avustralya, Yeni Zelanda, Avustralya, Almanya, Birleşik Krallık ve Amerika Birleşik Devletleri’nde ‘Bilgi Edinme Hakkı Kanunu’ çerçevesinde benzer sorgulamalarda bulunmuş iki gazeteciyi de eklememiz lazım, zira 5 Eylül itibariyle on iki resmi kurum yapılmış başvuruya yanıt vermiş durumda ve hepsi de aynı şeyi söylüyor; ellerinde Covid 19’a yol açmış olması lazım gelen virüsün izolasyonunu tarif eden çalışma kaydı yok. Sorulara verilen resmi yanıtların detayları şuradan görülebilir: https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-ofcovid-19-virus-isolation/ 

DÜZMECE GENOMUN ÇIKIŞ NOKTASI NERESİ

Bu durumda kendimize sorduğumuz soru şu oldu: Tıbbi yayınlarda bahsi edilen gen dizilimleri -iddia edildiği gibi- yeni birtakım virüslere ait değilse, nereden çıkmış olabilirler? Bu sorunun cevabını bulmak için de, verili gen dizilimini Birleşik Devletler’in Milli Sağlık Enstitüleri’nde kayıtlı tüm dizilimlerle kıyaslamamıza olanak verecek bir ‘dizilim sırası arama gereci’ olan Basic Local Alignment Search Tool (BLAST) adlı bir bilgisayar programı kullandık. (ABD’nin milli sağlık enstitüleri kamusal erişime açık olup şuradan sorgulama yapılabiliyor: https://blast.ncbi.nlm.nih.gov/Blast.cgi.)  Neyi nasıl yaptığımızı burada sizlere adım adım anlatacağız ki, okurlarımız da girip aratsın ve sonuçların sağlamasını yapabilsin. 

Önce WHO’nun internet sitesinde o zaman gösterilmekte olan protokollerde tanımlı PCR inisiyatörlerinin [başlatıcılar] hepsini topladık:  

– Çin CDC’sinin protokolü: hedef olarak ORF1ab ve N genlerini kullanıyor.

– Fransa’nın Pastör Enstitüsü’ne (Pasteur Institute) ait protokol: RdRP geninin iki fragmanını kullanıyor (RdRP geninin SARS-CoV-2’ye özel bir gen olduğu iddiası var). 

– Birleşik Devletler CDC’sinin protokolü: N geninden üç fragman (parça, bölüm) kullanıyor. 

– Japonya’nın Milli Enfeksiyon Hastalıklar Enstitüsünün protokolü: Diğer koronavirüsler ile ortak olduğu öne sürülen diğer genlerin yanırısa, hedef olarak S genini kullanan tek protokol bu.  

– Charite Protokolü (Almanya): E, N ve RdRP genlerini kullanıyor. 

Hong Kong Üniversitesi‘nin Protokolü: ORF1b-nsp14 ve N genini kullanıyor.

– Tayland Milli Sağlık Enstitüsü protokolü: N genini kullanıyor.

Ardından BLAST programına primerlerin dizilimlerini (aranan dizilimin başı ve arama yönüne göre de sonunu gösteren sekanstır bu) girdik ve bunları hem mikrop hem de insan genomlarının toplamından oluşan iki veritabanında arattık.

SARS-COV-2’DİR DENİLEN SEKANSLAR HEM İNSAN HEM DE MİKROP GENOMUNDA OLAN SEKANSLAR!

Fransızların protokolündeki inisiyatörlerden örnekle, prosedürün nasıl işlediğinin ayrıntısına girelim. İnternetten BLAST programının sitesine girdikten sonra, mikrobiyel genom veritabanında arama yapmak için Microbes’u seçtik ve sonraki sayfaya geçtik. Sonra, ekrana gelen formda ilgili yere, Fransızların protokolünün düz inisiyatörüne ait dizilimi (ATGAGCTTAGTCCTGTG) girdik. Yakınen benzeşen (“highly similar”) dizilimler seçeneğini işaretledik ve BLAST tuşuna batık. Birkaç saniyede sonuçlar ekrandaydı, ekran görüntüsünü aldık (1 no’lu resim) ve kimliği %100 bilinen mikropların gen dizilimlerinden oluşan ve girdiğimiz hedef dizilim ile %77 ila %100 oranında örtüşen 100 adet mikroba -bilhassa bakteri ve arkeye- ait gen dizilimi çıktı karşımıza.  

Buradan tekrar ana sayfaya geçip, bu defa da İnsan (Human) seçeneğini işaretleyip aynı dizilimi insan genomunda arattık ve birkaç saniyede ekrana gelen sonuçların yine ekran görüntüsünü (2 no’lu resim) aldık. Meğer bu gen diziliminin %66 ila %100 oranları arasında eşleştiği ve bilinirliği %100 olan tam 74 dizilim varmış insan genomunda. 

SARS-CoV-2’ye özeldir denilen bu PCR başlangıç primeri, insan genlerindeki 74 kısımla örtüştüğü yetmiyormuş gibi, mikrop genlerine ait fragmanların da 100’üyle çakışıyor!

Bir de testen yazıldığındaki (bitiş) primeri (CTCCCTTTGTGTGTGT) için aynı işlemi tekrarladığımızda sonuçlar benzer çıktı.

Bunlar oldukça kısa dizilimler (sekans) olduğundan (topu topu yirmi kadar genetik harf yahut nükleotidden oluşuyorlar), bir kez daha arama yapalım ama bu sefer bu iki primerle başlayıp biten hedef sekansa (yani SARS-CoV-2’ye ait olduğu iddia edilen genomun, başta ve sonda bulunan bu iki primer arasında kalan bölümüne) bakalım istedik. Bunu yapabilmek için de haliyle, resmi makamlarca “SARS-CoV-2 genomu” ilan edilmiş dizilime ihtiyacımız var. Biz bu virüsü izole ettik ve sekansladık diye ortaya çıkan binlerce laboratuvar var (ki önceki raporlarda açıkladığımız gibi asılsız iddialardır bunlar), ancak biz Milli Biyoteknoloji Bilişim Merkezi’nin internet sitesini (https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2? report=genbank&to=29903) tercih ettik. Siteye girdiğimizde “hedef dizilim”i bulduk; “genom”un 12,690 ve 12,797 konumları arasında kalan 108 nükleotidlik bir fragmandı bu: ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACAACAACAAAGGGAG

Bu defa da bu dizilimle yukarıda anlattığımız işlem basamaklarını aynen tekrar ettiğimizde sonuç yine şaşırtıcıydı, zira mikrop genlerinden %100 eşleşme gösteren yüz adet dizilim de burada çıktı, yanında da insan genomundan %83 ila %95’lik benzeşme oranı ile dört dizilim bulduk. Bundaki eşleşme sayısı daha az evet, fakat burada önemli olan, SARS-CoV-2 diye servis edilen “hedef dizilim”e ait bölümleri istikrarlı şekilde hem mikroplarda hem de kendi genomumuzda buluyor olmamız.

Hayretler içerisinde, bari bir de bu virüsün en belirgin ve kati genidir denilen ve zarf proteinlerinin üretiminden sorumlu olduğu öne sürülen, yeri 26,245 ve 26,472 konumları arasındaki bölüm olan E genini girip aratalım diye düşündük. Bahsi geçen E geni şu: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA.

Aynı işlemler üzerinden bu geni arattığımızda sonuç daha da şaşırtıcı oldu. Bunca uzun bir dizilim olmasına rağmen kimliği %100 tanımlanabilen 100 adet mikrop sekansı da bununla eşleşti, üstüne de %80 ila %100’lük eşleşme oranıyla insan genomuna ait 10 dizilim bulundu. Rastgele aldığımız bir gen bölümünden yine benzer sonuç aldık, ayrıca bir de SARS-CoV-2 nükleokapsidinin proteinlerine karşılık geliyor dedikleri N genine baktığımızda da yine benzer eşleşmeler gördük.

Son olarak bir de şu hücre içine girmede kilit roldeki yapısal “spike” proteinlerini yapıyor, o bakımdan da SARS-CoV-2’nin en spesifik genidir dedikleri S genini test edelim dedik. Bu, 21,563. ve 25,384. konumlar arasındaki 3821 nükleotidden oluşan çok daha uzun bir dizilim olduğundan iki yerden rastgele seçtiğimi bölümlerini alıp arattık ve arattığımız ilk bölüm (TTGGCAAAATTCAAGACTCACTTTC) bir diğer 100 mikrop geni sekansı ile 93 de insan gen sekansına karşılık geldi, ikinci bölüm (CTTGCTGCTACTAAATGCAGAGTGT) de mikrobiyel gen sekanslarından 100’ü ile isan gen sekanslarının 90’ıyla eşleşti. 

S genini hedef dizilim olarak kullanan tek ülke olduğundan Japon Protokolü’nün inisiyatörleriyle araştırmamızı sonlandıralım istedik ve okuyucunun çoktan tahmin etmiş olacağı üzere bunda da oldukça yakın sonuçlar elde ettik: mikroplara ait gen dizilimlerinden 100’ü ile, aidiyet oranı %94.12 ila %100 arasında değişen, insana ait 93 gen dizilimi ile örtüşme!

SONUÇ 

Tüm bu anlattıklarımızdan çıkarımlanacak sonuç gayet açık: SARS-CoV-2 TESPİTİ YAPMADA KULLANILACAK GEÇERLİ TEST YOK DÜNYADA; ne antikor veya antijen testi ne de RT-PCR. S1 diye geçen spike proteinini kodladığı iddia edilen gen üzerinden çalışanları da dahil ettik. Yani bu tam olarak şu demek: TÜM BU “VAKA”, “ENFEKTE İNSAN”, “HASTA”, “ASEMPTOMATİK” YAHUT “COVID-19 ÖLÜMÜ” SAYI VE İSTATİSTİKLERİNİN HİÇBİR BİLİMSEL TEMELİ YOK VE TÜM “POZİTİFLER” DE HATALI POZİTİF. Bu bilginin insanlara bir an evvel verilmesi, sorumluların da kanun önünde hesap vermesi lazım. 

Bu bölümü kapatırken, WHO’nun bile bu testlere itimadının olmadığını eklemek istiyoruz. Bunun için 11 Eylül’de SARS-CoV-2 laboratuvar kılavuzu olarak yayımladıkları belgeye bakmak kafi (Diagnostic tests for SARS-CoV-2https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve). Sayfa 5’te aynen şu söyleniyor: “Şüpheli aktif enfeksiyon vakaları mümkün mertebe RT-PCR gibi bir nükleik asit amplifikasyon testi (NAAT) ile test edilmelidir. NAAT testlerindeki hedef gen SARS-CoV-2 genomundan olmalıdır, lakin şu anda dünyada SARS-CoV-1 dolaşımı sözkonusu olmadığından, hedef olarak bir Sarbekovirüs dizilimi de (aralarında SARS-CoV-1 ve SARS-CoV-2 de olmak üzere insan ve hayvan koronavirüslerinden en az beşini ihtiva ettiği düşünülen virüs dizilimi) kullanılabilir.” Yani WHO, SARS-CoV-2 tetkiki için non-spesifik dizilim kullanımını onaylıyor. 

Sırf bu da değil, kılavuzda daha sonra deniyor ki, “Optimal teşhis, SARS-CoV-2 için genomdan bağımsız en az iki hedefin tanımlı olduğu bir NAAT testi ile yapılmalı, ancak hastalık bulaşının yaygın olduğu yerlerde teşhis için basit bir ‘tek hedefli’ algoritma da kullanılabilir.”

WHO kılavuzunda göre , “Bir veya iki negatif sonuç alınmış olması SARS-CoV-2 enfeksiyonu olmadığı anlamına gelmez. Enfekte bir bireyde sonucun negatif çıkmasına neden olabilecek çok sayıda faktör vardır, bunlar arasında örneğin alınan numunenin düşük kalitede olması, geç aşamada alınmış olması, düzgün muhafaza edilmemesi yahut testle ilgili virüsün mutasyona uğraması veya PCR inhibasyonu gibi teknik nedenler sayılabilir.”

Soruyoruz. Bu ülkenin hakimleri savcıları harekete geçmek için ne bekliyor?

Jesus Garcia Blanca 

Not: Yazar, bilimsel makale taraması ve BLAST programı ile girişilen ziyadesiyle ayrıntılı ve emek isteyen çalışmalardaki sabrı ve yardımları için Juan Pedro Aparicio Alcaraz’a teşekkür eder.

Raporun yayımlandığı adres: https://www.dsalud.com/revistas/numero-242-noviembre-2020/

Okumaya Devam Et

Kanadalı Doktorlar Konuşuyor / Video

Kanada Sağlık Birliği adına halkı bilgilendirmek amacıyla çekilmiş video metnidir: Covid'den Korkmamıza Gerek Yok; İşte Başlıca GerekçelerKanadalı...

Dr. Wofgang Wodarg’ın Korona Salgını Değerlendirmesi

Dr. Wofgang Wodarg’ın Korona Salgını Değerlendirmesi

‘Kral Çıplak!’ masalını andırıyor bu durum.
Çıkıp “Hey, kral çıplak!” diyebilen bir tek küçük bir çocuk oluyor orada.
Divana doluşmuş diğer herkes; hükümet bilir, ne yapılacağını ona danışalım diyen kalabalıklar, hepsi oyuna katılmış oynuyor, yaygaraya kaptırmış kendini.
Aynen bu şekilde, devlet kapısı ve siyasilerin etrafı da dalkavukluk eden birsürü bilimadamıyla çevrili.
Kurumlarına para kazandırmanın yolunu arayan, bunun için siyasi erk kazanmaya bakan bilimadamları bunlar.
Hakim görüşün güçlü akıntısına bırakmış kendini giden,
“Biz de yardımcı olabiliriz!”, “Bakın bir Uygulama yaptık!”, “Veri programı geliştirdik!” diyenler bunlar…
“Biz de yardımcı olalım!” diyen sürüyle insan…
Para kazanmanın ve mevki sahibi olmanın peşindeler de ondan.
Olaylara akılcı bir şekilde yaklaşım yok maalesef ortada.

Kimse çıkıp sormuyor:

“Bu virüsün tehlikeli olduğunu nasıl anladınız?”
“Bundan önce durum nasıldı?”
“Geçtiğimiz sene de aynını yaşamadık mı biz?”, “Bu şey YENİ mi gerçekten?”

Yok bunları soran…

Oysa gerçek şu ki; Kral Çıplak…

Dr. Wolfgang Wodarg

Bunlar Da İlginizi Çekebilir

Broşür baskı

Hazırladığımız broşürler de, pek çok mecrada dağıtılmaya devam ediyor. Bastırmak , dağıtmak...

Son haberler

Mahmut Demirkan’dan Açık Mektup ve Bir Davet

Sayın vatandaşlarımız, bu açık mektubum ve davetim sizleredir. Bu videomda üç konuya değineceğim.(Video sayfanın alt kısmına eklenmiştir) 1. Bölümde : Yedi ay önce yaptığım açıklamalarımdan sonra neler yaşadığımı, 2. Bölümde : Son 15 ayda hayatımıza hakim olan...

mRNA Aşılarının Minik Sırrı – Vaksinologdan Büyük İfşa

“Büyük hata yaptık. Diken proteininden şahane hedef antijen olur diye düşündük ama bunun aslen bir toksin olduğunu, patojenik (hastalık yapıcı) bir protein olduğunu bilmiyorduk. İnsanlara aşıyla toksin veriyoruz, bunların bir kısmı kan dolaşımına giriyor ve başta...

Broşür baskı

Hazırladığımız broşürler de, pek çok mecrada dağıtılmaya devam ediyor. Bastırmak , dağıtmak isteyenler için bağlantı aşağıda. Aşağıdaki linkten pdf olarak indirebilir, matbaada bastırarak dağıtabilirsiniz.. brosur_baskıİndir

Corona Sürecindeki Hikayelerine Talibiz

Bizimle konu hakkındaki her türlü duygu, düşünce ve yorumunu paylaşarak bu platforma sen de katkı sağlayabilirsin.

Bize Katıl

Yabancı dilden Türkçe’ye çeviri konusunda destek olmak ya da kendi alanın çerçevesinde paylaşımlarımıza katkı sağlamak istersen, bize yazabilirsin.

Bizi takip et

Güncel paylaşımlardan haberdar olmak ister misin?