RT-PCR KORONAVİRÜS TESTİ İLE İLGİLİ TÜM HUSUSLAR

RT-PCR KORONAVİRÜS TESTİ İLE İLGİLİ TÜM HUSUSLAR

David Crowe
23 Nisan 2020
Versiyon 3

Bu, RT-PCR teknolojisine istinaden yapılan sözde koronavirüs testinin bir analizidir. Bu çalışma önemli ölçüde, dünya çapında bir uzman olan Profesör Stephen Bustin‘ın RT-PCR ile ilgili olası sorunlar üzerine olan 2017 tarihli bir makalesini okumama, son zamanlarda onunla birlikte yürüttüğüm bir podcast’e ve RT-PCR verilerinin işlenmesi ve raporlanmasına dair MIQE yönergelerine dayanmaktadır. Bu makale, testte kullanılan RNA’nın viral mi yoksa endojen mi olduğunu sorgulamamaktadır.  RNA viral değilse, RT-PCR koronavirüs testinin hiçbir değeri olmadığı açıktır. Bu belgede billimsel referans verilmemiştir, ilgili yayınlar için Koronavirüs Paniği Kritiği başlıklı yazımıza bakılmalıdır.

PCR DÖNGÜ SAYISI


PCR algoritması döngüseldir. Her döngüde DNA (RT-PCR içerisinde sürecin başlatıldığı RNA’ya karşılık gelen) miktarının yaklaşık iki katını üretir. Test olarak kullanıldığında, başlangıç ​​materyalinin miktarını bilmezsiniz fakat her döngünün sonundaki DNA miktarı problara bağlanan floresan moleküller tarafından dolaylı olarak gösterilecektir.O zaman her adımdan sonra üretilen ışık miktarı yaklaşık olarak iki katına çıkar ve belli bir yoğunluğa ulaşınca işlem sonlandırılır, numune pozitif ilan edilir (numunenin enfekte olduğu kastedilir). Belli bir döngü sayısına ulaştıktan sonra hala yeterli DNA yoksa numune negatif ilan edilir (enfekte olmadığı anlamında). Pozitif ve negatifi ayırmak için kullanılan bu döngü eşik değeri (Ct) keyfidir ve testi yapan her kuruluş için aynı değildir. Örneğin, 36’yı pozitif için sona erme noktası, 37-39’u belirsiz, yani daha fazla test yapılmasını gerektiren ve 39’u negatif olarak rapor eden bir makale yayınlandı. Başka bir çalışma ise, ara alan olmadan, kesme noktası olarak 37’yi kullandı. Amerikan FDA tarafından onaylanan test kitlerinin olduğu listede, 30, 31, 35, 36, 37, 38 ve 39 döngülerinin her biri için bir üretici önerisi vardı,12 üretici tarafından seçilen 40 döngü sayısı ise en popüler olandı, 43 ve 45 döngü sayıları için ise birer üretici önerisi mevcuttu.

DÖNGÜ EŞİK DEĞERİNİN (Ct) MANASI

Ct değeri kullanırken varsayılan şey, kullanılan RNA miktarı aslına yaklaşık olursa (iki ile çarpımda) yine aynı Ct değerini vereceğidir. Oysa RT-PCR’de birçok yoldan hata oluşabilmektedir. RNA ekstraksiyon aşaması bile verimde bir sürü kayba gebeyken, RNA’nın komplemeter DNA’ya dönüştürülmesi aşamasında etkinlik bakımından verilecek fire daha da büyüktür (Prof. Bustin’e göre yapılan işlemde etkinliğin %50’nin üstüne çıktığı pek vaki olmayıp, rahatlıkla 10 katlık fark oluşabilmektedir) ve tabii PCR işleminin bizzat kendisi etkinlikte kayba yol açmaktadır. Podcast yayınında Bustin, keyfi Ct değerine göre hareket etmenin “tamamen saçmalık” olduğunu, bunun “akıl alır tarafı olmadığı”nı belirtmiştir. Farklı laboratuvarlarda testlerin aynı Ct değerine göre yapılmış olması, başlangıçtaki RNA miktarının aynı olduğu anlamına gelmemektedir.

DÖNGÜ KONUSUNDAKİ KISITLAR

Profesör Bustin 35 kezden fazla döngü yapmanın amaca uygun olmadığını ve mantıksızlığını belirttiği halde, hiç kimsenin bu döngü sayılarını 35 ve altında sınırlandırmadığı görülmektedir (MIQE ilkeleri 40’tan az döngü sayısını önermektedir). Çok fazla döngü yapıldığında arka plan flüorışıma artacağı için, bu durum sahte pozitiflikle sonuçlanabilir.

CT ve POZİTİF ÇIKAN TEST SAYISI


Ct döngü değeri, pozitif testlerin sayısını önemli ölçüde etkileyecektir. Ct 37’den 35’e çekilirse daha az, 39’a çıkarılırsa da daha fazla pozitif sonuç elde edilecektir.

CT döngü değeri belli bir standarda bağlansa bile, farklı laboratuvarlar tarafından kullanılan özel makinalar, kimyasallar ve prosedürlere bağlı olarak farklı anlamlar taşıyabilirler ve hatta aynı laboratuvardaki farklı numune türleri arasında bile değişiklikler bulunabilir. Miktarı belli bir ‘spike’ RNA alınıp iki ayrı makinede eşzamanlı olarak çoğaltıma sokulup çıkan sonuç karşılaştırılmadan, pozitif ve negatifliği tutarlı bir biçimde birbirinden ayırmamızı sağlayacak Ct değerine ulaşılması zordur.

MİKTARIN BİR ANLAMI VAR MI?


Randımanlı bir PCR işleminde dahi oldukça yüksek döngü sayısına rağmen tespit edilen RNA molekülü sayısı topu topu 3’te kalabiliyor. Vücudunda, herhangi bir sağlık sorunu bulunmasa dahi bu kadarcık bir virüs bile taşıyan varsa, onlar da testte pozitif çıkmış oluyor.

VİRÜS FONKSİYONEL Mİ DEĞİL Mİ?


Alınan numunede enfeksiyon kabiliyeti olmayan defektif virüs partikülleri veya virüsün yalnızca bir bölümü varsa bile test yine pozitif verecektir. PCR testi ile virüsün patojenik ve replikasyon kabiliyetine sahip oluop olmadığı anlaşılamaz.

RT-PCR TESTİ İLE ENFEKTE KİŞİYİ ENFEKTE OLMAYANDAN AYIRMAK MÜMKÜN MÜ?

Değildir.

RT-PCR’NİN ÇALIŞMA MEKANİZMASI


PCR ile belli bir RNA’yı aramak için şu işlemler uygulanır:

  1. RNA’nın numuneden çıkarılması (ekstraksiyon) gerekir. DNA karışmamasına çok dikkat edilmeli, bu işlem titizlikle yürütülmelidir. İleriki aşamalarda testin çalışmasını engelleyecek kimyasalların kullanılmaması gerekir. Elde edilenin saf RNA olmasını sağlamak mümkün değildir.

  2. RNA’nın komplementer DNA’ya (cDNA) dönüştürülmesi gerekir. Ters Transkritaz enzimi vasıtasıyla yapılan bu işlem hiçbir zaman yüzde yüz etkin değildir (randıman %50’de kalır). Ortaya ne kadar DNA çıkacağı ise birçok faktöre göre değişiklik gösterir, miktarda 10 katlık farklar gözlemlenebilir (eskiden 100 kat daha az veya daha çok olabiliyordu miktar).

  3. İşin PCR kısmında, primerleri ve probuyla (ve muhtemelen yanında biraz da, ayıklanamadığı için numuneden karışmış kaçak DNA ile birlikte) cDNA vardır sahnede. Primerler, kopyası çıkarılarak çoğaltılmak istenen cDNA’nın başını-sonunu belirler. Prob ise, RNA’nın ancak primerlerle eşleştiği takdirde (ki primerlerin boyu çok çok kısadır) çoğaltıma gitmesini sağlamaya yarar. Her döngüde (PCR proper’da) DNA miktarı yaklaşık iki katına çıkar. Proba floresan marker’ler iliştirilir ki, verdiği ışıktan her adımda kaç DNA üretilmiş olduğu aşağı yukarı anlaşılabilsin.

  4. İstendiği takdirde, bu şekilde üretilmiş DNA sekanslanarak tam olarak hangi bazlardan (dört farklı DNA boncuğundan (bead) müteşekkil yapı) oluştuğu da görülebilir.

Bu işlemlerin her bir aşaması hataya ve randımansızlığa açıktır. Miktarı kestirmek ise reaksiyona başka bir RNA’dan belli bir miktar karıştırılmadan mümkün dahi değildir, kaldı ki o katılan RNA da sonra kopyalanıp çoğaltılmaya başlar. İlk başta elde ne kadar materyal varsa, PCR’nin yapacağı döngü sayısı da kabaca bunun azlığı veya çokluğu ile ilişkili olacaktır.

TESTLERİN SORUNLU OLDUĞU SALT BİR HİPOTEZDEN Mİ İBARET YOKSA ELDE KANIT VAR MI?

Bu testlerin çıkardığı imkansız sonuçları açıkça görebileceğimiz çok sayıda yayın bulunmakta.

Çin’de yapılan bir çalışmada araştırmacılar art arda yapılan test sonuçlarını Negatif (N), Pozitif (P) veya kuşkulu (D, negatif-pozitif arası bir noktada) şeklinde kodluyor. Test edilen 600 hastadan 29’unda çıkan şu sonuçlara hiçbir açıklama getirilemiyor: 1 DDPDD 2 NNPN 3 NNNPN 4 DNPN 5 NNDP 6 NDP 7 DNP 8 NDDPN 9 NNNDPN 10 NNPD 11 DNP 12 NNNP 13 PPNDPN 14 PNPPP 15 DPNPNN 16 PNNP 17 NPNPN 18 PNP 19 NPNP 20 PNPN 21 PNP 22 PNP 23 PNP 24 PNDDP 25 PNPNN 26 PNPP 27 PNP 28 PNPN 29 PNP. 

Singapur’da yapılan bir çalışmada, 18 hasta neredeyse her gün test ediliyor ve çoğu da en az bir kez önce Pozitif sonra Negatif ve ertesi gün tekrar Pozitif çıkıyor. Hatta bir hasta tam dört kez bu patterni gösteriyor.

Çin’de, birbirini izleyen iki negatif testin sonucunda temiz ilan edilen hastaların %5 ila %14 kadarı daha sonra yeniden, çoğunda semptom dahi yokken bir daha pozitif çıkıyor. Güney Kore’de de yakın zamanda bu tür 91 vaka bildirilmiştir. 

68 yaşında bir Çinli semptomları olduğu için hastaneye gidiyor ve testi pozitif çıkıyor. Semptomlar düzeldikten sonra iki negatif test de verince taburcu ediliyor. Bir süre sonraki takip testinde yeniden pozitif çıkınca hastaneye geri alınıyor, düzelince iki negatifle yeniden salınıyor, takip testi bir daha pozitif verince gene yatırılıyor ve ardından üçüncü kez taburcu ediliyor.

SONUÇ


Tüm bunlardan yola çıkarak şu sonucu söylemek mümkündür:

Koronavirüs tespiti için RT-PCR testi kullanımı, mümkün olduğunca çok sayıda pozitif sonuç üretmek için tasarlanmışa benzemektedir. Gerçek pozitifleri kaçırma korkusu o denli büyük ki, RT-PCR’ye dayalı test metodolojisini düzenleyenlerin, yanlış pozitif riskini tamamıyla göz ardı etmiş oldukları görülmektedir. Yanlış pozitiflerle şişirilen salgın ise ekonominin tamamıyla kilit altına alınması, insanların evlerine hapsedilmesi, parkta top oynamak, arkadaşlarıyla kahve içmek, tiyatro veya spor aktivitelerine gitmek, yüzmek veya bir fuara gitmek gibi insalara hayatlarında mutluluk veren her unsurun tahrip edilmesine mazaret olarak kullanılmaktadır.

© Telif Hakkı 16 Mart 2021. David Crowe 

Bu makale Coronaloji sitesi için Sn. Zehra Yıldırım tarafından çevrilmiştir.

Yanlış Virüs Teorisi ve Anlamsız PCR Testi – Video

Yanlış Virüs Teorisi ve Anlamsız PCR Testi – Video

“Viroloji ve aşı bilmi tamamıyla tek bir önerme üzerine kurulu, o da virüslerin hasta edici, enfeksiyöz ajanlar olduğu”, demiştik sitemizdeki bir başka yazıda. Oysa ağdası tıbbın içindekiler bile bakmaya cesaret edemesin diye özellikle koyu tutulmuş jargonu, gözümüzle gördüğümüz gerçeklerle hiçbir şekilde uyuşmasa da dogma adına biat etmeye zorlandığımız temelsiz “teoriler” ve asılsız “varsayımlar” bütünü virolojinin şu an, gen ve bilgisayar teknolojileri ile girdiği dünyaevinin ortaya çıkardığı bilim-kurgu filminin sonu gelmeyen ve ancak bizim sonumuzu getireceği kesin bölümlerinin hiçbir söz hakkı olmayan figüranları durumundayız.

Akla yatkın açıklamaları reddetmeyelim.

Doğruları görmekten ve ifade etmekten çekinmeyelim.

Ezberlerimizi ya şimdi bozalım ya sozsuza dek susalım.

Virüs denilen genetik kod paketleri gerekli anlarda hücremizin yaptığı, vücudumuzun kendini savunma, temizleme, önlem alma ve hücreler-dokular-organlar-sistemler arası haberleşme sisteminin ulakları, mesaj kodları mı? Evet.

Adına ister virüs ister eksozom deyin, bunlar bizi iyileştirmek için var, hasta etmek için değil.

Bulaşmıyorlar; herkes kendi virüsünü (eksozomunu) kendisi yapıyor; gerektiği tipini yapıyor; anında uyarlıyor (kimileri buna “mutasyon” diyor); gerektiği miktarda yapıyor.

Gerçek manada virüs izolasyonu yapılıp, “virüs” tek başına alınıp herhangi bir canlıya tanıtıldığında hasta etmiyor. O yüzden virüsü illâ başka hayvan hücre ve dokuları ile birlikte, içine birtakım antibiyotikler, formaldehid, alüminyum gibi zehirler ilave edip vücuda tanıtıyorlar ki bağışıklık sistemi —virüse değil— bu zehirlere karşı görevini yapsın, alarma geçsin. Saf halde, yalın olarak bir virüs (eksozom) yapısının kimseyi hasta ettiği şu ana kadar ispatlanabilmiş değil.

Sitemizden virüs izolasyonundaki sorunları anlatan yazılar eşliğinde videoyu izlemenizi salık veririz.

.aude sapere.




Korona’nın dayandığı temel çökebilir! PCR Testi, Kıbrıs’ta Dava edildi!

Korona’nın dayandığı temel çökebilir! PCR Testi, Kıbrıs’ta Dava edildi!

 

 

Önümüzdeki günlerde dünyanın bir numaralı dava konusu olacak olan PCR’a ilk dava KKTC’de açıldı. Kızı, ailesi, vatanı ve insanlık için dava açtığını söyleyen Seda OKGÜL’ün iddialarını 28 yıldır KKTC’de avukatlık yapan ve sosyal faaliyetleri ile tanınan Boysan BOYRA savunacak, konuyla ilgili duyarlılığı ve araştırmaları ile tanınan Dr. Nurçin İNCİRLİ’de tanık olarak yer alıyor.

 

https://www.habervakti.com/gundem/korona-nin-dayandigi-temel-cokebilir-pcr-testi-kibris-ta-h137719.html

https://www.5gvirusnews.com/hukuk/pcr-dunyada-ilk-kez-kktcde-yargilanacak-h484.html

 

 

Daha önce Portekiz de 11 Kasım 2020 tarihinde açılan bir davada mahkeme, PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin karar verdi. 23 Kasım 2020 tarihinde ise Berlin’de PCR tanı kitini DSÖ’ye kabul ettiren Christian Drosten’in sahte salgına neden olduğu için hakkında dava açıldı. Bunun üzerien DSÖ, 14 Aralık 2020 ve 20 Ocak 2021 tarihinde PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin açıklama yaptı.

Dünya’da Seda OKGÜL’ün KKTC Yüksek İdare Mahkemesi’nde açtığı davada PCR tanı kiti ilk kez yargılanıyor..

 

 

DAVA METNİ

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.

                                                                                                                      YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

 

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

   Başsavcılığı, Lefkoşa.

                                                                                                           Arasında

Yukarıdaki Davacı Tarafından

TALEP TAKRİRİ

Malumunuz olsun ki, yukarıda adı yazılı davacı aşağıdaki çareler için Mahkemeye başvurur;

Şöyle ki;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının  hükümsüz ve/veya etkisiz ve/veya herhangi bir sonuç doğurmayacağına dair karar verilmesini;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup , açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının bir ihmal olduğuna ve/veya böyle bir ihmalin yapılmaması gereken bir ihmal olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının iptal edilmesi gereken bir karar olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar yoklukla  maluldur  ve/veya mutlak butlanla sakattır  dolayısı ile mezkur karar etkisiz,  hükümsüz ve/veya herhangi bir sonuç doğurmayacak bir karardır ve dolayısı ile iptal edilmesi gereken bir karar olduğu hususunda bir emir.

İşbu dava masraflarıdır.

İşbu dava KKTC Anayasasının 152. Maddesine, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere istinad eder.

Bu Dava Aşağıdaki Hukuki Esaslara Dayanır:

  1. Davalı dava konusu kararı değerlendirirken ve/veya dava konusu kararı alırken  ihmalde bulundu. Keza davacının haklarını ihlal etmekte ve/veya davacıyı mağdur etmektedir.
  1. Davalının, Dava konusu karar ve/veya işlemleri ve/veya eylemleri Anayasaya ilgili mevzuata ve/veya Doğal Aalet ilkelerine ve/veya Hak ve Nisfet Hukuku kaidelerine aykırı ve/veya gayrı yasaldır ve/veya hükümsüzür.
  1. Davalı 27/02/2021 tarihli kararı istihsal ederken ve/veya ve/veya değerlendirme yaparken ilgili mevzuatı yanlış anlamış ve/veya hatalı uygulamış ve/veya eksik uygulamışdır.
  1. Dava konusu karar ve/veya işlem ve/veya işlemler gerekçeden yoksundur ve/veya keyfidir ve/veya hatalı değerlendirmelere dayanmaktadır ve/veya yasal dayanağı yoktur ve/veya kanunilik ilkesine aykırı bir şekilde karar alınmıştır.  
  1. Davalı, Dava konusu kararı alıırken ve/veya işlemleri yaparken  yeterli inceleme ve/veya araştırma yapmadı  ve/veya eksik ve/veya  hatalı inceleme yaptı . Ayni nedenle bunlar neticesinde  hatalı kararlar istihsal etti ve/veya  işlemler yaptı .
  1. Dava konusu karar alınırken ve/veya işlemler yapılırken davalı yetkilerini aştı  ve/veya yetkisiz olarak karar aldı  ve/veya yetki aşımı ile kararlar aldı ve/veya bu kararlar doğrultusunda işlemler yaptı  ve/veya yetkilerini kötüye kullandı  ve  dava konusu kararları bu suretle istihsal etti.

Bu Davayı Desteklemek İçin Aşağıdaki Olgulara Dayanılır:

  1. Davacı Lefkoşa’da ikamet etmekte olup, takriben ve/veya 19 yıldır Avukatlık mesleği ile iştigal etmektedir.
  1. Davalı No.1, KKTC Bakanlar Kurulu olup, yönetsel faaliyetlerde bulunan ve/veya genel siyaseti belirlemekte ve/veya yasa gücünde kararname çıkarmakta ve/veya Anayasa’da belirtilmiş ve/veya sayılmış görevleri yerine getirmektedir. Davalı No.2 KKTC Sağlık Bakanlığı Anayasanın 45. Maddesi gereğince “herkesin beden ve ruh sağlığı içinde yaşayabilmesini ve tıbbi bakım görmesini sağlama ödevi olan yürütsel ve yönetsel yetki kullanan bir organ ve/veya  makam ve/veya Bakanlıktır ve/veya kamu tüzel kişiliğine haizdir. Davalı No.3 Davalı No.2’ye bağlı olarak faaliyet göstermekte ve/veya 45/2018 sayılı Bulaşıcı Hastalıklar Yasası kapsamında kurulan bir kurul ve/veya komitedir.
  1. Takriben ve/veya 2019 yılı sonlarında Çin’de başladığı iddia olunan ve daha sonra dünya genelinde 17 Ocak 2020 tarihinde DSÖ tararından kabul edilen PCR tanı kiti ile  Şubat 2020 yılı itibarı ile dünya genelinde görülmeye başlamış ve Covid-19 olarak isimlendirilmiş ve/veya 12/03/2020  tarihinde de Dünya Sağlık Örgütü tarafından pandemi ilan edilmiştir. Bunun üzerine tüm devletler toplum sağlığı iddiası ile önlem almışlar ve/veya zaman zaman da bu önlem ve/veya tedbirlerini değiştirmek ve/veya sürece uydurmak adına da farklı önlemler almışlar ve/veya Anayasa’da yer alan kişi hak ve özgürlüklerini kısıtlamak sureti ile de önlem ve/veya tedbirlerini değiştirmişlerdir.  
  1. Bu süre içerisinde ve/veya dünya genelinde Covid-19 olarak isimlendirilen virüs sonucu DSÖ tarafından ilan edilen pandemi, PCR testi için boğaz ve burundan sürüntü örneği alınarak tespit edilmeye çalışılmıştır.
  1. Davacı iddia ve beyan eder ki; süreç içerisinde yapılan çalışmalar ve/veya tıbbi çalışmalar ve/veya gözlemler neticesinde PCR olarak adlandırılan test kitlerinin kullanılması doğru değildir ve/veya hatalıdır. Davalıların bu konudaki kararlarının ayrıca yasal hiçbir zemini de yoktur. Şöyle ki;
  1. YASAL OLARAK:
  1. a) Davacı iddia ve beyan eder ki, PCR test kitleri ile Covid-19 virüsünün tespit edileceğine ve/veya edilmesi gerektiğine dair yasal herhangi bir zorunluluk yoktur ve/veya PCR testinin uygulanacağına ve/veya uygulanmasının zorunlu olacağına dair icbar mümkün değildir ve yasada da düzenlenmiş değildir. Her halukarda 45/2018 sayılı yasaya göre bir kimsenin muayene edilebilmesi için Mahkeme emri dahi aranmaktadır.

Her halukarda Virüsler kan testleri ve sair testlerle ve/veya antijen testleri ile de tespit edilebilecekleri gibi PCR, sürüntü testlerinin yasal olarak yer almaması nedeni ile kullanılmaya mecbur bırakılmasına dair alınmış karar ve/veya kararlar ve bu kararlar nedeni ile yapılan işlemler hatalıdırlar.

b)Davacı iddia ve beyan eder ki, 45/2018 sayılı yasa muayene edilmek hususunda zorunluluk getirmemektedir. Dolayısı ile PCR testleri ile sağlıklı olup olunmadığına dair muayene işlemi zorlanamaz ve/veya zorunlu olarak PCR testleri yapmak hususunda icbar edinilemez. Dolayısı ile Davalıların müştereken ve/veya münferiden PCR testleri ile hastalığın ve/veya Covid-19 virüsünün tespit edilmesi için muayene maksatlı PCR testi yapılmasına dair almış oldukları kararlar hatalıdır.

  1. BİLİMSEL VE/VEYA TIBBİ OLARAK:

a)PCR Testlerinin amacı Virüs Tespit etmek değilidir.

Davacı iddia eder ki, PCR sürüntü testleri genetik hastalıklar ve/veya prenetal tanı, adli tıp, kanser araştırmaları, babalık testleri, DNA analizi gibi analizlerin yapılması için yapılmıştır.

b)Yanlış pozitif çıkarabilir.

PCR Testleri spesifik ve güvenli testler değidir. PCR Testlerinin döngü sayısı DSÖ tarafından 14 Aralık 2020 ve  20 Ocak 2021 tarihinde de Başkan Tedors Adhanom Ghebreyesus’un daha önce kabul edilen  45 döngünün fazla pozitif  bulduğundan aşağı çekilmesi istenmiştir.

Yine alınan numunede başka virüs RNA/DNA’sının olması halinde (Influenza virüsü gibi), bunların döngüye girip kopyalanma ihtimali ve boyamada yanlış pozitif çıkma ihtimali vardır.

c)Davacı iddia eder ki, SARS-CoV2 virüsü izole edilmemiş olduğundan ve DSÖ’nün kabul ettiği (17 Ocak 2020) protokolde bu durum açıkça yazılmış olmasına rağmen test sonuçlarının doğruluk oranını saptamak için kullanılabilecek bir altın standart yoktur, olamazda. O nedenle bu testlerde elde edilecek sonuçlar tümüyle geçersizdir.

Ahar surette;

d)Virüs izolasyonu olduğu kabul edilse bile kullanımda mevcut sürüntü testlerinin hiçbirinin resmi verifikasyon ve validasyonu yoktur ve/veya ruhsatsızdır.

e)Cihazların %99’unda hangi gen diziliminin olduğu bilinmemektedir ve/veya sürüntü testlerinin birçoğunda, taşıdıkları gen dizilimleri (sekansları) deklare edilmiş ve/veya açıklanmış değil.

f)PCR testinin tekrar sayısına göre ölü virüsün geninin de çoğaltılarak, virüs aktifmiş gibi PCR pozitif sonucunu verebilir ancak bu aktif bir enfeksiyonun kanıtı değildir.

g)PCR testleri döngü sayısı göre %63-65 arası pozitif  yakalamaktadır. Sırf bu nedenle dahi güvenilir değildir.

h)PCR testleri sonuçlarını bilimsel olarak zayıf pozitif şeklinde vermez. Oysa bu mümkündür ancak PCR testi buna fırsat tanımaz ve PCR pozitif gösterir.

ı)E, N ve RdRp2 geninin herhangi birinin varlığı halinde yeterli pozitiflik kabul edildiğinden pozitif sayısı fazla görünmektedir. Oysa bu Nisan 2020 tarihine kadar her üç genin de aranması yönünde idi.

i)Virüsün mutasyona uğruyorsa, önceden hazırlanan test kitleri ile bugün mevcut virüsü aramak mantık dışıdır. Yine virüs her ülke ve coğrafyaya göre değişiklik gösterdiği iddia edildiğinden bu test kitleri geçersiz sayılmalıdır.

j)Gen dizilimi için model olarak kullanılan patojenik sıvılarda ne bir virüs titrasyonu ne de kuantifikasyonu yapılmış olduğundan, buradan, o sıvılar dahilinde milyarlarca virüs benzeri partikülün (insan organizmasında doğal olarak bulunan ve patojenik özellik taşımayan ekstraselüler veziküller dahil) bulunduğu anlaşılabilir.

k)Esas itibariyle, farinjiyal veya nazal COVID-19 sürüntü testlerinin hiçbir diyagnostik   değeri bulunmamaktadır.

l)PCR testleri burun içerisine nazofarenks denilen bölgeye kadar inmekte ve sürüntü bu bölgeden alınmaktadır. PCR testleri üzerinde mevcut herhangi bir bakteri bu bölgeye sürüntü testi ile aktarıldığı taktirde kişinin hastalanmasına yol açmaktadır. Dolayısı ile işlemin yapılışı açısından da hatalı ve/veya risklidir.

            C)BİREYSEL OLARAK:

Davacı iddia eder ki, PCR testlerinin üretilmesinin temel amacı virüs tespiti değil, DNA analizidir. Her halukarda PCR testlerinin nasıl imha edildiği belli olmamakla birlikte bir toplumun da DNA örnekleri alınmaktadır. Dolayısı ile aynı zamanda etik de değildir ve/veya kimsenin DNA’sı zorlanmak sureti ile ve/veya alınacak kararlarla ve/veya rızası dışında da temin edilmemelidir. Nitekim Davalıların müştereken ve/veya münferiden almış olduğu kararlar Davacının DNA’sının da alınması neticesini doğuracaktır ki, Davacının buna rızası yoktur.

  1. Davacı iddia ve beyan eder ki, Davalıların müştereken ve/veya münferiden almış oldukları kararlar nedeni ile ve/veya 15 günde bir yenilenmek kaydı ile PCR testi yaptırtmak ile ilgili kararları neticesinde Davacının çalışma hakkı da etkilenmektedir. Davacı PCR testi olmaksızın çalışamama ihtimali ve dolayısı ile kendisini ekonomik olarak geliştirememe ihtimali taşımaktadır ki yasal dayanağı olmayan bir test ile Davacının Anayasal hakları etkilenecektir. Yine bu test ile hatalı pozitif olma ihtimali söz konusu olabilir. Bir kimsenin pozitif çıkması ile kişi Anayasaya aykırı bir şekilde kişi özgürlüğünden yoksun bırakılarak Karantina otellerine yerleştirilmekte ve kendisine derhal tıbbi tedavi uygulanmaya başlanmaktadır. Her halukarda uygulanan tedavinin tedavi protokolü dahi bulunmamaktadır ve/veya Davalı No.2 ve/veya No.3’ün uyguladığı tedavi PCR pozitif olup, gerek hatalı, gerekse gerçek pozitif olan kimselerde ciddi sağlık sorunlarına yol açmaktadır ve/veya Davalı No.2 ve/veya No.3 ve/veya Davalılar müştereken ve/veya münferdien PCR pozitif kimselere hatalı ve/veya yanlış ve/veya gereksiz tedavi de uygulayabilmektedirler. Dolayısı ile muhtemel bir hatalı pozitif, yukarıdaki iddialara halel gelmeksizin bir kişinin temel hak ve özgürlüklerini sınırlayacağı gibi ve/veya kişi özgürlüğünü sınırlayacağı gibi, ülke içerisinde gereksiz önlemlerin alınmasına sebebiyet vermek sureti ile Anayasa’da yer alan birçok kişi hak ve özgürlüklerinden men edilmesini sağlayacak tedbirler alınması sağlanacak ve/veya kişilerin ve/veya spesifik olarak Davacının Çalışma Hakkı, Hayat ve vücut bütünlüğü hakkı, sağlıklı yaşama hakkı ve/veya sağlık hakkı gibi hakları da etkilenecektir.

7.Davacı iddia ve beyan eder ki, Davalının yapmış olduğu işlemlerin ve/veya almış oldukları kararlarda ve bu konuda verilmiş olan karar ve/veya yapılmış olan işlem ve/veya eylem ve/veya ihmal tamamen hatalıdır ve/veya yanlıştır. Bu karar ve/veya kararlar Davacıyı zarar ve ziyanlara düçar bırakmakta ve mağdur etmektedir ve dolayısı ile işbu kararın iptal edilmesi gerekmektedir.

8.İşbu YİM konusu karar ve/veya işlemler nedeni ile Davacının işbu YİM davasını dosyalama mecburiyeti hasıl olmuştur ve/veya işbu kararların alınması ve/veya bu hususta yapılan işlemlerin ve/veya 27/02/2019 tarihli karar nedeni ile Davacının münferiden meşru menfaatleri etkilenmektedir ve işbu davayı dosyalamakta da meşru menfaati bulunmaktadır.

İşbu dava Davacı Avukatı Boysan Boyra tarafından tanzim edilmiştir.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa’dır.

                                                              Boysan Boyra

                                                      Davacı Tarafından Avukat

………/….03…../2021 tarihinde

kaydolunup mühürlenmiştir.

                                      Mukayyit.

Not: Bu davaya verilecek bir müdafaanın davanın tebliğ tarihinden itibaren yirmi bir (21) gün zarfında kayıt kalemine bizzat veya Avukat vasıtasıyle verilir ve bir sureti davacıların tebliğ adresine bırakılır.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

                Başsavcılığı  Lefkoşa, KKTC.

                                                                                                          ARASINDA.

                                                                                  

Yukarıdaki Müstedi tarafından yapılmış tek taraflı istida:

Yukarıdaki Müstedi işbu istidası ile;

  1. Esas başvurunun nihai bir karara bağlanmasına ve/veya Muhterem Mahkeme’ce takdir ve tayin edilecek bir tarihe kadar; Davalılar tarafından müştereken ve/veya münferiden takriben ve/veya 27/02/2021 tarihinde alınan ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararın icraasını men edici bir emir ve/veya geçici bir ara emri verilmesi ve/veya yürütmenin durdurulmasına dair bir emir verilmesi zımnında bir Mahkeme emri itası;
  1. Muhterem mahkemece uygun görülecek başka bir emir ve/veya çare.
  1. Bu istida masraflarının M/aleyhlere tahmili.

 için gerekli emrin isdarını talep eder.

İşbu başvuru KKTC. Anayasa’sının 152, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere ve Yüksek Mahkeme Tüzüğüne istinad eder.

Bu istidada istinad edilen gerçekler Lefkoşa   sakinlerinden Seda Okgül’ün  ilişikte sunulan  yemin varakasında gösterilmektedir.

 

Bu istida Müstedinin Avukatı Boysan Boyra tarafından yapılmıştır.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı altı, Lefkoşa’dır.

                                                                                                          Boysan Boyra

                                                                                              Müstedi Tarafından Avukat.

2021  senesinin Mart  ayının   2. günü

dosyalanmıştır. Dinlenmesi için  2021 senesi

Mart ayının …………..gününe tayin edilmiştir.                 

                                                                                                                                                                    Mukayyit.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

3.Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle                   Başsavcılık  Lefkoşa.

                                                                                                          ARASINDA.

                                                                           

 

                                                        YEMİN BELGESİ

Ben aşağıda imza sahibi Lefkoşa  sakinlerinden Seda Okgül , yemin eder ve bu yeminimle aşağıda gösterilen hususları beyan ederim.

  1. Yukarıda unvan ve sayısı gösterilen başvuruda davacı ve işbu istidada ise  Müstediyim.
  1. Bu istida maksatları bakımından esas başvurumdaki tüm iddiaları burada aynen tekrarlar ve benimserim.
  1. DSÖ tarafından ilan edilen pandemi nedeni ile Covid-19 virüsünün tespiti bir nevi PCR testlerine bağlanmıştır. Oysa ki PCR testleri dışında başka alternatif testler vardır. Mesela kan testleri ve sair testler uygulanarak virüsler tespit edilebilir. Davamda da açık olarak belirtmiş olduğum gibi, PCR testleri ciddi hatalar vermektedir. Her halukarda özetle;

Bu testlerin yasal dayanağı yoktur. Herhangi bir kimsenin bir başka kimseyi Bulaşıcı Hastalıklar yasası Tahtında muayene edebilmesi için Mahkeme emrine ihtiyaç duyması gerekmekte iken, Davalı/M/aleyhler yasa dışı bir şekilde ve/veya Almış oldukları ve yayınladıkları kararlar ile zorunlu olarak PCR testi yaptırtmak surety ile muayeneye tabi tutmaya çalışmaktadırlar. Ancak az önce bahsettiğim üzere bunu yapabilmek ilgili yasada Mahkeme ermine bağlanmışken, Davalılar yetki aşımı yapmak suretiyle ve icbar ederek, PCR testi vasıtası ile Covid-19 virüsünü tespit etmeye çalışmaktadırlar. Her halukarda mezkur muayeneyi hasta oluğundan şüphelenilen kişiler yerine sağlıklı kişiler üzerinde yapmaktadırlar ki, bu test ve alınan kararlar amacı aşmaktadır.

Yine mezkur testler birçok sebeple hatalı sonuç vermektedirler. Herhangi bir virüsün varlığı ve/veya ölü bir virus varlığı dahi, PCR testlerinin döngüsünde çoğaltılmakta ve aşırı çoğaltmada (-ki döngü sayısı değiştirilmiş olmasına rağmen) Davalılar PCR testlerinin ve/veya ilk nazarda DSÖ nün Kabul edip daha sonra değiştirdiği döngü sayısını uygulamakta ısrar etmekte ve hatalı pozitifler yaratmaktadırlar.

Bir diğer önemli husus ise mezkur testler sürüntü testleri olup, bu testler burun ve akabinde boğaza sürüntü yapılarak yani, tükürük de alınarak yapılmaktadır. İddia ederim ki, PCR testleri DNA analizleri yapmak için kullanılan test türleridir. Davalılar müştereken ve/veya münferiden kararlar almak suretiyle şahsıma ait DNA analizlerini çıkarabileceklerdir. Ancak böyle bir hususa rızam yoktur. Böyle birşey bedenime ait olan anahtarın tümü ile Davalıların eline geçmesine neden olacağından, bedenimin tüm zayıflıklarını tespit edebilme ihtimaline de yol açacaktır. Kaldı ki, mezkur testlerin imha edilip edilmediği, ve/veya nasıl ve ne şekilde imha edildiği belli değildir, hiç açıklanmamıştır. Şahsen bu husus beni ayrıca rahatsız etmektedir.  Kendi bedenim ve sağlığım üzerinde söz hakkım bulunmakta olduğuna inanmaktayım.

  1. İddia ve beyan ederim ki, Davalıların bu kararı aynı zamanda Anayasa ile korunma altına alınan kişi hak ve özgürlüklerin özüne dokunmaktadır.
  1. Her halukarda Davalıların baz aldığı bu PCR testleri ifade etmiş olduğum gibi hatalı pozitif vermekte ve/veya bir kimse önce pozitif, sonra negatif veya döngüye göre pozitif vermektedir. Herhangi bir şekilde hatalı pozitif temin edilmesi halinde,  Anayasaya aykırı olduğunu düşündüğüm karantina otellerine kapatılarak tedavi edilmem sonucunu dahi doğurabilecektir ki, Davalı No.2’nin uyguladığı sağlık protokolleri belirsizdir ve/veya yanlış uygulamalar olduğu duyumlarını almaktayım .
  1. Yukarda yer alan tüm nedenlerle  ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar inancım odur ki, yoklukla malul bir karardır ve/veya hatalıdır ve bu nedenle de hükümsüz ve/veya etki doğurmaması gereken bir karardır ve işbu nedenle de iptal edilmesi gerekmektedir.
  1. İddia ve beyan ederim ki, Davalıların almış olduğu karar ve/veya işbu karar doğrultusunda yapılan işlemler, açıkça kanuna aykırıdır. Hatta kanuni değildir ve yasal dayanağı yoktur.
  1. Yine,  iddia ve beyan ederim ki, karara bağlanması gereken kony ciddidir ve iddialarımda haklı olduğuma dair belirtiler mevcuttur, keza ara emri verilmez ise ileride telafisi mümkün olmayacak bir zararın doğması mümkündür. Mesela mezkur karar çalışma hakkımı engellemekte, hatalı bir netice de ortaya koyabileceği ve tedavi görmeme neden olabileceği gibi, DNA mın temin edilmesine de neden olacaktır. Kaldı ki, alınan kararlar gereği PCR testi yaptırmış değilim ve yaptırmak konusunda da rızam yoktur ve/veya yaptırmak zorunda olmadığıma da inanmaktayım. 
  1. Yukarıdakiler gereğince karara bağlanması gereken konunun çok ciddi ve acil olduğu inancındayım ve davanın adilane bir şekilde kararlaştırılabilmesi için böyle bir emrin verilmesine ihtiyaç olduğuna inanmaktayım.
  1. Tüm yukarıda iddia etmiş olduğum sebeplerle bu  istida ile talep edilen emrin verilmemesi halinde ileride telafisi imkansız zarar ziyana uğramam söz konusu olacak, geriye dönüş imkansızlaşacaktır ve/veya çok zorlaşacağına inanmaktayım.
  2. Yukarıda gerçekler ışığında istida da olduğu gibi emir verilmesinin adil ve hakkaniyete uygun olduğu inancı ile bu doğrultuda talepte bulunurum.

                                                                      Yemin eden

                                                           ……………………………………

Seda Okgül  

2021Yılı Mart ayının 2..günü

yemin ve imza edilmiştir.                   Mukayyit.         

 

 

https://www.habervakti.com/gundem/korona-nin-dayandigi-temel-cokebilir-pcr-testi-kibris-ta-h137719.html

https://www.5gvirusnews.com/hukuk/pcr-dunyada-ilk-kez-kktcde-yargilanacak-h484.html

 

 

[/et_pb_text][/et_pb_column][/et_pb_row][/et_pb_section]Dava metninde dünyanın her yerinde olduğu gibi KKTC’de ne işe yaradığı belli olmayan PCR test kiti ile insanların bedenine müdahale edildiği ve bunun da yasalarda yer olmadığı yer aldı.

Daha önce Portekiz de 11 Kasım 2020 tarihinde açılan bir davada mahkeme, PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin karar verdi. 23 Kasım 2020 tarihinde ise Berlin’de PCR tanı kitini DSÖ’ye kabul ettiren Christian Drosten’in sahte salgına neden olduğu için hakkında dava açıldı. Bunun üzerien DSÖ, 14 Aralık 2020 ve 20 Ocak 2021 tarihinde PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin açıklama yaptı.

Dünya’da Seda OKGÜL’ün KKTC Yüksek İdare Mahkemesi’nde açtığı davada PCR tanı kiti ilk kez yargılanıyor..

 

 

DAVA METNİ

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.

                                                                                                                      YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

 

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

   Başsavcılığı, Lefkoşa.

                                                                                                           Arasında

Yukarıdaki Davacı Tarafından

TALEP TAKRİRİ

Malumunuz olsun ki, yukarıda adı yazılı davacı aşağıdaki çareler için Mahkemeye başvurur;

Şöyle ki;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının  hükümsüz ve/veya etkisiz ve/veya herhangi bir sonuç doğurmayacağına dair karar verilmesini;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup , açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının bir ihmal olduğuna ve/veya böyle bir ihmalin yapılmaması gereken bir ihmal olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının iptal edilmesi gereken bir karar olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar yoklukla  maluldur  ve/veya mutlak butlanla sakattır  dolayısı ile mezkur karar etkisiz,  hükümsüz ve/veya herhangi bir sonuç doğurmayacak bir karardır ve dolayısı ile iptal edilmesi gereken bir karar olduğu hususunda bir emir.

İşbu dava masraflarıdır.

İşbu dava KKTC Anayasasının 152. Maddesine, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere istinad eder.

Bu Dava Aşağıdaki Hukuki Esaslara Dayanır:

  1. Davalı dava konusu kararı değerlendirirken ve/veya dava konusu kararı alırken  ihmalde bulundu. Keza davacının haklarını ihlal etmekte ve/veya davacıyı mağdur etmektedir.
  1. Davalının, Dava konusu karar ve/veya işlemleri ve/veya eylemleri Anayasaya ilgili mevzuata ve/veya Doğal Aalet ilkelerine ve/veya Hak ve Nisfet Hukuku kaidelerine aykırı ve/veya gayrı yasaldır ve/veya hükümsüzür.
  1. Davalı 27/02/2021 tarihli kararı istihsal ederken ve/veya ve/veya değerlendirme yaparken ilgili mevzuatı yanlış anlamış ve/veya hatalı uygulamış ve/veya eksik uygulamışdır.
  1. Dava konusu karar ve/veya işlem ve/veya işlemler gerekçeden yoksundur ve/veya keyfidir ve/veya hatalı değerlendirmelere dayanmaktadır ve/veya yasal dayanağı yoktur ve/veya kanunilik ilkesine aykırı bir şekilde karar alınmıştır.  
  1. Davalı, Dava konusu kararı alıırken ve/veya işlemleri yaparken  yeterli inceleme ve/veya araştırma yapmadı  ve/veya eksik ve/veya  hatalı inceleme yaptı . Ayni nedenle bunlar neticesinde  hatalı kararlar istihsal etti ve/veya  işlemler yaptı .
  1. Dava konusu karar alınırken ve/veya işlemler yapılırken davalı yetkilerini aştı  ve/veya yetkisiz olarak karar aldı  ve/veya yetki aşımı ile kararlar aldı ve/veya bu kararlar doğrultusunda işlemler yaptı  ve/veya yetkilerini kötüye kullandı  ve  dava konusu kararları bu suretle istihsal etti.

Bu Davayı Desteklemek İçin Aşağıdaki Olgulara Dayanılır:

  1. Davacı Lefkoşa’da ikamet etmekte olup, takriben ve/veya 19 yıldır Avukatlık mesleği ile iştigal etmektedir.
  1. Davalı No.1, KKTC Bakanlar Kurulu olup, yönetsel faaliyetlerde bulunan ve/veya genel siyaseti belirlemekte ve/veya yasa gücünde kararname çıkarmakta ve/veya Anayasa’da belirtilmiş ve/veya sayılmış görevleri yerine getirmektedir. Davalı No.2 KKTC Sağlık Bakanlığı Anayasanın 45. Maddesi gereğince “herkesin beden ve ruh sağlığı içinde yaşayabilmesini ve tıbbi bakım görmesini sağlama ödevi olan yürütsel ve yönetsel yetki kullanan bir organ ve/veya  makam ve/veya Bakanlıktır ve/veya kamu tüzel kişiliğine haizdir. Davalı No.3 Davalı No.2’ye bağlı olarak faaliyet göstermekte ve/veya 45/2018 sayılı Bulaşıcı Hastalıklar Yasası kapsamında kurulan bir kurul ve/veya komitedir.
  1. Takriben ve/veya 2019 yılı sonlarında Çin’de başladığı iddia olunan ve daha sonra dünya genelinde 17 Ocak 2020 tarihinde DSÖ tararından kabul edilen PCR tanı kiti ile  Şubat 2020 yılı itibarı ile dünya genelinde görülmeye başlamış ve Covid-19 olarak isimlendirilmiş ve/veya 12/03/2020  tarihinde de Dünya Sağlık Örgütü tarafından pandemi ilan edilmiştir. Bunun üzerine tüm devletler toplum sağlığı iddiası ile önlem almışlar ve/veya zaman zaman da bu önlem ve/veya tedbirlerini değiştirmek ve/veya sürece uydurmak adına da farklı önlemler almışlar ve/veya Anayasa’da yer alan kişi hak ve özgürlüklerini kısıtlamak sureti ile de önlem ve/veya tedbirlerini değiştirmişlerdir.  
  1. Bu süre içerisinde ve/veya dünya genelinde Covid-19 olarak isimlendirilen virüs sonucu DSÖ tarafından ilan edilen pandemi, PCR testi için boğaz ve burundan sürüntü örneği alınarak tespit edilmeye çalışılmıştır.
  1. Davacı iddia ve beyan eder ki; süreç içerisinde yapılan çalışmalar ve/veya tıbbi çalışmalar ve/veya gözlemler neticesinde PCR olarak adlandırılan test kitlerinin kullanılması doğru değildir ve/veya hatalıdır. Davalıların bu konudaki kararlarının ayrıca yasal hiçbir zemini de yoktur. Şöyle ki;
  1. YASAL OLARAK:
  1. a) Davacı iddia ve beyan eder ki, PCR test kitleri ile Covid-19 virüsünün tespit edileceğine ve/veya edilmesi gerektiğine dair yasal herhangi bir zorunluluk yoktur ve/veya PCR testinin uygulanacağına ve/veya uygulanmasının zorunlu olacağına dair icbar mümkün değildir ve yasada da düzenlenmiş değildir. Her halukarda 45/2018 sayılı yasaya göre bir kimsenin muayene edilebilmesi için Mahkeme emri dahi aranmaktadır.

Her halukarda Virüsler kan testleri ve sair testlerle ve/veya antijen testleri ile de tespit edilebilecekleri gibi PCR, sürüntü testlerinin yasal olarak yer almaması nedeni ile kullanılmaya mecbur bırakılmasına dair alınmış karar ve/veya kararlar ve bu kararlar nedeni ile yapılan işlemler hatalıdırlar.

b)Davacı iddia ve beyan eder ki, 45/2018 sayılı yasa muayene edilmek hususunda zorunluluk getirmemektedir. Dolayısı ile PCR testleri ile sağlıklı olup olunmadığına dair muayene işlemi zorlanamaz ve/veya zorunlu olarak PCR testleri yapmak hususunda icbar edinilemez. Dolayısı ile Davalıların müştereken ve/veya münferiden PCR testleri ile hastalığın ve/veya Covid-19 virüsünün tespit edilmesi için muayene maksatlı PCR testi yapılmasına dair almış oldukları kararlar hatalıdır.

  1. BİLİMSEL VE/VEYA TIBBİ OLARAK:

a)PCR Testlerinin amacı Virüs Tespit etmek değilidir.

Davacı iddia eder ki, PCR sürüntü testleri genetik hastalıklar ve/veya prenetal tanı, adli tıp, kanser araştırmaları, babalık testleri, DNA analizi gibi analizlerin yapılması için yapılmıştır.

b)Yanlış pozitif çıkarabilir.

PCR Testleri spesifik ve güvenli testler değidir. PCR Testlerinin döngü sayısı DSÖ tarafından 14 Aralık 2020 ve  20 Ocak 2021 tarihinde de Başkan Tedors Adhanom Ghebreyesus’un daha önce kabul edilen  45 döngünün fazla pozitif  bulduğundan aşağı çekilmesi istenmiştir.

Yine alınan numunede başka virüs RNA/DNA’sının olması halinde (Influenza virüsü gibi), bunların döngüye girip kopyalanma ihtimali ve boyamada yanlış pozitif çıkma ihtimali vardır.

c)Davacı iddia eder ki, SARS-CoV2 virüsü izole edilmemiş olduğundan ve DSÖ’nün kabul ettiği (17 Ocak 2020) protokolde bu durum açıkça yazılmış olmasına rağmen test sonuçlarının doğruluk oranını saptamak için kullanılabilecek bir altın standart yoktur, olamazda. O nedenle bu testlerde elde edilecek sonuçlar tümüyle geçersizdir.

Ahar surette;

d)Virüs izolasyonu olduğu kabul edilse bile kullanımda mevcut sürüntü testlerinin hiçbirinin resmi verifikasyon ve validasyonu yoktur ve/veya ruhsatsızdır.

e)Cihazların %99’unda hangi gen diziliminin olduğu bilinmemektedir ve/veya sürüntü testlerinin birçoğunda, taşıdıkları gen dizilimleri (sekansları) deklare edilmiş ve/veya açıklanmış değil.

f)PCR testinin tekrar sayısına göre ölü virüsün geninin de çoğaltılarak, virüs aktifmiş gibi PCR pozitif sonucunu verebilir ancak bu aktif bir enfeksiyonun kanıtı değildir.

g)PCR testleri döngü sayısı göre %63-65 arası pozitif  yakalamaktadır. Sırf bu nedenle dahi güvenilir değildir.

h)PCR testleri sonuçlarını bilimsel olarak zayıf pozitif şeklinde vermez. Oysa bu mümkündür ancak PCR testi buna fırsat tanımaz ve PCR pozitif gösterir.

ı)E, N ve RdRp2 geninin herhangi birinin varlığı halinde yeterli pozitiflik kabul edildiğinden pozitif sayısı fazla görünmektedir. Oysa bu Nisan 2020 tarihine kadar her üç genin de aranması yönünde idi.

i)Virüsün mutasyona uğruyorsa, önceden hazırlanan test kitleri ile bugün mevcut virüsü aramak mantık dışıdır. Yine virüs her ülke ve coğrafyaya göre değişiklik gösterdiği iddia edildiğinden bu test kitleri geçersiz sayılmalıdır.

j)Gen dizilimi için model olarak kullanılan patojenik sıvılarda ne bir virüs titrasyonu ne de kuantifikasyonu yapılmış olduğundan, buradan, o sıvılar dahilinde milyarlarca virüs benzeri partikülün (insan organizmasında doğal olarak bulunan ve patojenik özellik taşımayan ekstraselüler veziküller dahil) bulunduğu anlaşılabilir.

k)Esas itibariyle, farinjiyal veya nazal COVID-19 sürüntü testlerinin hiçbir diyagnostik   değeri bulunmamaktadır.

l)PCR testleri burun içerisine nazofarenks denilen bölgeye kadar inmekte ve sürüntü bu bölgeden alınmaktadır. PCR testleri üzerinde mevcut herhangi bir bakteri bu bölgeye sürüntü testi ile aktarıldığı taktirde kişinin hastalanmasına yol açmaktadır. Dolayısı ile işlemin yapılışı açısından da hatalı ve/veya risklidir.

            C)BİREYSEL OLARAK:

Davacı iddia eder ki, PCR testlerinin üretilmesinin temel amacı virüs tespiti değil, DNA analizidir. Her halukarda PCR testlerinin nasıl imha edildiği belli olmamakla birlikte bir toplumun da DNA örnekleri alınmaktadır. Dolayısı ile aynı zamanda etik de değildir ve/veya kimsenin DNA’sı zorlanmak sureti ile ve/veya alınacak kararlarla ve/veya rızası dışında da temin edilmemelidir. Nitekim Davalıların müştereken ve/veya münferiden almış olduğu kararlar Davacının DNA’sının da alınması neticesini doğuracaktır ki, Davacının buna rızası yoktur.

  1. Davacı iddia ve beyan eder ki, Davalıların müştereken ve/veya münferiden almış oldukları kararlar nedeni ile ve/veya 15 günde bir yenilenmek kaydı ile PCR testi yaptırtmak ile ilgili kararları neticesinde Davacının çalışma hakkı da etkilenmektedir. Davacı PCR testi olmaksızın çalışamama ihtimali ve dolayısı ile kendisini ekonomik olarak geliştirememe ihtimali taşımaktadır ki yasal dayanağı olmayan bir test ile Davacının Anayasal hakları etkilenecektir. Yine bu test ile hatalı pozitif olma ihtimali söz konusu olabilir. Bir kimsenin pozitif çıkması ile kişi Anayasaya aykırı bir şekilde kişi özgürlüğünden yoksun bırakılarak Karantina otellerine yerleştirilmekte ve kendisine derhal tıbbi tedavi uygulanmaya başlanmaktadır. Her halukarda uygulanan tedavinin tedavi protokolü dahi bulunmamaktadır ve/veya Davalı No.2 ve/veya No.3’ün uyguladığı tedavi PCR pozitif olup, gerek hatalı, gerekse gerçek pozitif olan kimselerde ciddi sağlık sorunlarına yol açmaktadır ve/veya Davalı No.2 ve/veya No.3 ve/veya Davalılar müştereken ve/veya münferdien PCR pozitif kimselere hatalı ve/veya yanlış ve/veya gereksiz tedavi de uygulayabilmektedirler. Dolayısı ile muhtemel bir hatalı pozitif, yukarıdaki iddialara halel gelmeksizin bir kişinin temel hak ve özgürlüklerini sınırlayacağı gibi ve/veya kişi özgürlüğünü sınırlayacağı gibi, ülke içerisinde gereksiz önlemlerin alınmasına sebebiyet vermek sureti ile Anayasa’da yer alan birçok kişi hak ve özgürlüklerinden men edilmesini sağlayacak tedbirler alınması sağlanacak ve/veya kişilerin ve/veya spesifik olarak Davacının Çalışma Hakkı, Hayat ve vücut bütünlüğü hakkı, sağlıklı yaşama hakkı ve/veya sağlık hakkı gibi hakları da etkilenecektir.

7.Davacı iddia ve beyan eder ki, Davalının yapmış olduğu işlemlerin ve/veya almış oldukları kararlarda ve bu konuda verilmiş olan karar ve/veya yapılmış olan işlem ve/veya eylem ve/veya ihmal tamamen hatalıdır ve/veya yanlıştır. Bu karar ve/veya kararlar Davacıyı zarar ve ziyanlara düçar bırakmakta ve mağdur etmektedir ve dolayısı ile işbu kararın iptal edilmesi gerekmektedir.

8.İşbu YİM konusu karar ve/veya işlemler nedeni ile Davacının işbu YİM davasını dosyalama mecburiyeti hasıl olmuştur ve/veya işbu kararların alınması ve/veya bu hususta yapılan işlemlerin ve/veya 27/02/2019 tarihli karar nedeni ile Davacının münferiden meşru menfaatleri etkilenmektedir ve işbu davayı dosyalamakta da meşru menfaati bulunmaktadır.

İşbu dava Davacı Avukatı Boysan Boyra tarafından tanzim edilmiştir.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa’dır.

                                                              Boysan Boyra

                                                      Davacı Tarafından Avukat

………/….03…../2021 tarihinde

kaydolunup mühürlenmiştir.

                                      Mukayyit.

Not: Bu davaya verilecek bir müdafaanın davanın tebliğ tarihinden itibaren yirmi bir (21) gün zarfında kayıt kalemine bizzat veya Avukat vasıtasıyle verilir ve bir sureti davacıların tebliğ adresine bırakılır.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

                Başsavcılığı  Lefkoşa, KKTC.

                                                                                                          ARASINDA.

                                                                                  

Yukarıdaki Müstedi tarafından yapılmış tek taraflı istida:

Yukarıdaki Müstedi işbu istidası ile;

  1. Esas başvurunun nihai bir karara bağlanmasına ve/veya Muhterem Mahkeme’ce takdir ve tayin edilecek bir tarihe kadar; Davalılar tarafından müştereken ve/veya münferiden takriben ve/veya 27/02/2021 tarihinde alınan ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararın icraasını men edici bir emir ve/veya geçici bir ara emri verilmesi ve/veya yürütmenin durdurulmasına dair bir emir verilmesi zımnında bir Mahkeme emri itası;
  1. Muhterem mahkemece uygun görülecek başka bir emir ve/veya çare.
  1. Bu istida masraflarının M/aleyhlere tahmili.

 için gerekli emrin isdarını talep eder.

İşbu başvuru KKTC. Anayasa’sının 152, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere ve Yüksek Mahkeme Tüzüğüne istinad eder.

Bu istidada istinad edilen gerçekler Lefkoşa   sakinlerinden Seda Okgül’ün  ilişikte sunulan  yemin varakasında gösterilmektedir.

 

Bu istida Müstedinin Avukatı Boysan Boyra tarafından yapılmıştır.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı altı, Lefkoşa’dır.

                                                                                                          Boysan Boyra

                                                                                              Müstedi Tarafından Avukat.

2021  senesinin Mart  ayının   2. günü

dosyalanmıştır. Dinlenmesi için  2021 senesi

Mart ayının …………..gününe tayin edilmiştir.                 

                                                                                                                                                                    Mukayyit.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

3.Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle                   Başsavcılık  Lefkoşa.

                                                                                                          ARASINDA.

                                                                           

 

                                                        YEMİN BELGESİ

Ben aşağıda imza sahibi Lefkoşa  sakinlerinden Seda Okgül , yemin eder ve bu yeminimle aşağıda gösterilen hususları beyan ederim.

  1. Yukarıda unvan ve sayısı gösterilen başvuruda davacı ve işbu istidada ise  Müstediyim.
  1. Bu istida maksatları bakımından esas başvurumdaki tüm iddiaları burada aynen tekrarlar ve benimserim.
  1. DSÖ tarafından ilan edilen pandemi nedeni ile Covid-19 virüsünün tespiti bir nevi PCR testlerine bağlanmıştır. Oysa ki PCR testleri dışında başka alternatif testler vardır. Mesela kan testleri ve sair testler uygulanarak virüsler tespit edilebilir. Davamda da açık olarak belirtmiş olduğum gibi, PCR testleri ciddi hatalar vermektedir. Her halukarda özetle;

Bu testlerin yasal dayanağı yoktur. Herhangi bir kimsenin bir başka kimseyi Bulaşıcı Hastalıklar yasası Tahtında muayene edebilmesi için Mahkeme emrine ihtiyaç duyması gerekmekte iken, Davalı/M/aleyhler yasa dışı bir şekilde ve/veya Almış oldukları ve yayınladıkları kararlar ile zorunlu olarak PCR testi yaptırtmak surety ile muayeneye tabi tutmaya çalışmaktadırlar. Ancak az önce bahsettiğim üzere bunu yapabilmek ilgili yasada Mahkeme ermine bağlanmışken, Davalılar yetki aşımı yapmak suretiyle ve icbar ederek, PCR testi vasıtası ile Covid-19 virüsünü tespit etmeye çalışmaktadırlar. Her halukarda mezkur muayeneyi hasta oluğundan şüphelenilen kişiler yerine sağlıklı kişiler üzerinde yapmaktadırlar ki, bu test ve alınan kararlar amacı aşmaktadır.

Yine mezkur testler birçok sebeple hatalı sonuç vermektedirler. Herhangi bir virüsün varlığı ve/veya ölü bir virus varlığı dahi, PCR testlerinin döngüsünde çoğaltılmakta ve aşırı çoğaltmada (-ki döngü sayısı değiştirilmiş olmasına rağmen) Davalılar PCR testlerinin ve/veya ilk nazarda DSÖ nün Kabul edip daha sonra değiştirdiği döngü sayısını uygulamakta ısrar etmekte ve hatalı pozitifler yaratmaktadırlar.

Bir diğer önemli husus ise mezkur testler sürüntü testleri olup, bu testler burun ve akabinde boğaza sürüntü yapılarak yani, tükürük de alınarak yapılmaktadır. İddia ederim ki, PCR testleri DNA analizleri yapmak için kullanılan test türleridir. Davalılar müştereken ve/veya münferiden kararlar almak suretiyle şahsıma ait DNA analizlerini çıkarabileceklerdir. Ancak böyle bir hususa rızam yoktur. Böyle birşey bedenime ait olan anahtarın tümü ile Davalıların eline geçmesine neden olacağından, bedenimin tüm zayıflıklarını tespit edebilme ihtimaline de yol açacaktır. Kaldı ki, mezkur testlerin imha edilip edilmediği, ve/veya nasıl ve ne şekilde imha edildiği belli değildir, hiç açıklanmamıştır. Şahsen bu husus beni ayrıca rahatsız etmektedir.  Kendi bedenim ve sağlığım üzerinde söz hakkım bulunmakta olduğuna inanmaktayım.

  1. İddia ve beyan ederim ki, Davalıların bu kararı aynı zamanda Anayasa ile korunma altına alınan kişi hak ve özgürlüklerin özüne dokunmaktadır.
  1. Her halukarda Davalıların baz aldığı bu PCR testleri ifade etmiş olduğum gibi hatalı pozitif vermekte ve/veya bir kimse önce pozitif, sonra negatif veya döngüye göre pozitif vermektedir. Herhangi bir şekilde hatalı pozitif temin edilmesi halinde,  Anayasaya aykırı olduğunu düşündüğüm karantina otellerine kapatılarak tedavi edilmem sonucunu dahi doğurabilecektir ki, Davalı No.2’nin uyguladığı sağlık protokolleri belirsizdir ve/veya yanlış uygulamalar olduğu duyumlarını almaktayım .
  1. Yukarda yer alan tüm nedenlerle  ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar inancım odur ki, yoklukla malul bir karardır ve/veya hatalıdır ve bu nedenle de hükümsüz ve/veya etki doğurmaması gereken bir karardır ve işbu nedenle de iptal edilmesi gerekmektedir.
  1. İddia ve beyan ederim ki, Davalıların almış olduğu karar ve/veya işbu karar doğrultusunda yapılan işlemler, açıkça kanuna aykırıdır. Hatta kanuni değildir ve yasal dayanağı yoktur.
  1. Yine,  iddia ve beyan ederim ki, karara bağlanması gereken kony ciddidir ve iddialarımda haklı olduğuma dair belirtiler mevcuttur, keza ara emri verilmez ise ileride telafisi mümkün olmayacak bir zararın doğması mümkündür. Mesela mezkur karar çalışma hakkımı engellemekte, hatalı bir netice de ortaya koyabileceği ve tedavi görmeme neden olabileceği gibi, DNA mın temin edilmesine de neden olacaktır. Kaldı ki, alınan kararlar gereği PCR testi yaptırmış değilim ve yaptırmak konusunda da rızam yoktur ve/veya yaptırmak zorunda olmadığıma da inanmaktayım. 
  1. Yukarıdakiler gereğince karara bağlanması gereken konunun çok ciddi ve acil olduğu inancındayım ve davanın adilane bir şekilde kararlaştırılabilmesi için böyle bir emrin verilmesine ihtiyaç olduğuna inanmaktayım.
  1. Tüm yukarıda iddia etmiş olduğum sebeplerle bu  istida ile talep edilen emrin verilmemesi halinde ileride telafisi imkansız zarar ziyana uğramam söz konusu olacak, geriye dönüş imkansızlaşacaktır ve/veya çok zorlaşacağına inanmaktayım.
  2. Yukarıda gerçekler ışığında istida da olduğu gibi emir verilmesinin adil ve hakkaniyete uygun olduğu inancı ile bu doğrultuda talepte bulunurum.

                                                                      Yemin eden

                                                           ……………………………………

Seda Okgül  

2021Yılı Mart ayının 2..günü

yemin ve imza edilmiştir.                   Mukayyit.         

 

 

https://www.habervakti.com/gundem/korona-nin-dayandigi-temel-cokebilir-pcr-testi-kibris-ta-h137719.html

https://www.5gvirusnews.com/hukuk/pcr-dunyada-ilk-kez-kktcde-yargilanacak-h484.html

 

 

[/et_pb_text][/et_pb_column][/et_pb_row][/et_pb_section]Açılan davada COVİD-19 virüsünün İZOLATLARI, yani enfekte olmuş bir kişiden veya doğal ortamdan elde edilmiş, laboratuvar kökenli olmayan, mikrobiyal veya viral anlamda saf bir numune olmadığı halde, PCR tanı kiti ile pozitif sonuç tespit edilerek vaka sayısı oluşturulduğu belgelendi.

Dava metninde dünyanın her yerinde olduğu gibi KKTC’de ne işe yaradığı belli olmayan PCR test kiti ile insanların bedenine müdahale edildiği ve bunun da yasalarda yer olmadığı yer aldı.

Daha önce Portekiz de 11 Kasım 2020 tarihinde açılan bir davada mahkeme, PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin karar verdi. 23 Kasım 2020 tarihinde ise Berlin’de PCR tanı kitini DSÖ’ye kabul ettiren Christian Drosten’in sahte salgına neden olduğu için hakkında dava açıldı. Bunun üzerien DSÖ, 14 Aralık 2020 ve 20 Ocak 2021 tarihinde PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin açıklama yaptı.

Dünya’da Seda OKGÜL’ün KKTC Yüksek İdare Mahkemesi’nde açtığı davada PCR tanı kiti ilk kez yargılanıyor..

 

 

DAVA METNİ

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.

                                                                                                                      YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

 

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

   Başsavcılığı, Lefkoşa.

                                                                                                           Arasında

Yukarıdaki Davacı Tarafından

TALEP TAKRİRİ

Malumunuz olsun ki, yukarıda adı yazılı davacı aşağıdaki çareler için Mahkemeye başvurur;

Şöyle ki;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının  hükümsüz ve/veya etkisiz ve/veya herhangi bir sonuç doğurmayacağına dair karar verilmesini;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup , açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının bir ihmal olduğuna ve/veya böyle bir ihmalin yapılmaması gereken bir ihmal olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının iptal edilmesi gereken bir karar olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar yoklukla  maluldur  ve/veya mutlak butlanla sakattır  dolayısı ile mezkur karar etkisiz,  hükümsüz ve/veya herhangi bir sonuç doğurmayacak bir karardır ve dolayısı ile iptal edilmesi gereken bir karar olduğu hususunda bir emir.

İşbu dava masraflarıdır.

İşbu dava KKTC Anayasasının 152. Maddesine, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere istinad eder.

Bu Dava Aşağıdaki Hukuki Esaslara Dayanır:

  1. Davalı dava konusu kararı değerlendirirken ve/veya dava konusu kararı alırken  ihmalde bulundu. Keza davacının haklarını ihlal etmekte ve/veya davacıyı mağdur etmektedir.
  1. Davalının, Dava konusu karar ve/veya işlemleri ve/veya eylemleri Anayasaya ilgili mevzuata ve/veya Doğal Aalet ilkelerine ve/veya Hak ve Nisfet Hukuku kaidelerine aykırı ve/veya gayrı yasaldır ve/veya hükümsüzür.
  1. Davalı 27/02/2021 tarihli kararı istihsal ederken ve/veya ve/veya değerlendirme yaparken ilgili mevzuatı yanlış anlamış ve/veya hatalı uygulamış ve/veya eksik uygulamışdır.
  1. Dava konusu karar ve/veya işlem ve/veya işlemler gerekçeden yoksundur ve/veya keyfidir ve/veya hatalı değerlendirmelere dayanmaktadır ve/veya yasal dayanağı yoktur ve/veya kanunilik ilkesine aykırı bir şekilde karar alınmıştır.  
  1. Davalı, Dava konusu kararı alıırken ve/veya işlemleri yaparken  yeterli inceleme ve/veya araştırma yapmadı  ve/veya eksik ve/veya  hatalı inceleme yaptı . Ayni nedenle bunlar neticesinde  hatalı kararlar istihsal etti ve/veya  işlemler yaptı .
  1. Dava konusu karar alınırken ve/veya işlemler yapılırken davalı yetkilerini aştı  ve/veya yetkisiz olarak karar aldı  ve/veya yetki aşımı ile kararlar aldı ve/veya bu kararlar doğrultusunda işlemler yaptı  ve/veya yetkilerini kötüye kullandı  ve  dava konusu kararları bu suretle istihsal etti.

Bu Davayı Desteklemek İçin Aşağıdaki Olgulara Dayanılır:

  1. Davacı Lefkoşa’da ikamet etmekte olup, takriben ve/veya 19 yıldır Avukatlık mesleği ile iştigal etmektedir.
  1. Davalı No.1, KKTC Bakanlar Kurulu olup, yönetsel faaliyetlerde bulunan ve/veya genel siyaseti belirlemekte ve/veya yasa gücünde kararname çıkarmakta ve/veya Anayasa’da belirtilmiş ve/veya sayılmış görevleri yerine getirmektedir. Davalı No.2 KKTC Sağlık Bakanlığı Anayasanın 45. Maddesi gereğince “herkesin beden ve ruh sağlığı içinde yaşayabilmesini ve tıbbi bakım görmesini sağlama ödevi olan yürütsel ve yönetsel yetki kullanan bir organ ve/veya  makam ve/veya Bakanlıktır ve/veya kamu tüzel kişiliğine haizdir. Davalı No.3 Davalı No.2’ye bağlı olarak faaliyet göstermekte ve/veya 45/2018 sayılı Bulaşıcı Hastalıklar Yasası kapsamında kurulan bir kurul ve/veya komitedir.
  1. Takriben ve/veya 2019 yılı sonlarında Çin’de başladığı iddia olunan ve daha sonra dünya genelinde 17 Ocak 2020 tarihinde DSÖ tararından kabul edilen PCR tanı kiti ile  Şubat 2020 yılı itibarı ile dünya genelinde görülmeye başlamış ve Covid-19 olarak isimlendirilmiş ve/veya 12/03/2020  tarihinde de Dünya Sağlık Örgütü tarafından pandemi ilan edilmiştir. Bunun üzerine tüm devletler toplum sağlığı iddiası ile önlem almışlar ve/veya zaman zaman da bu önlem ve/veya tedbirlerini değiştirmek ve/veya sürece uydurmak adına da farklı önlemler almışlar ve/veya Anayasa’da yer alan kişi hak ve özgürlüklerini kısıtlamak sureti ile de önlem ve/veya tedbirlerini değiştirmişlerdir.  
  1. Bu süre içerisinde ve/veya dünya genelinde Covid-19 olarak isimlendirilen virüs sonucu DSÖ tarafından ilan edilen pandemi, PCR testi için boğaz ve burundan sürüntü örneği alınarak tespit edilmeye çalışılmıştır.
  1. Davacı iddia ve beyan eder ki; süreç içerisinde yapılan çalışmalar ve/veya tıbbi çalışmalar ve/veya gözlemler neticesinde PCR olarak adlandırılan test kitlerinin kullanılması doğru değildir ve/veya hatalıdır. Davalıların bu konudaki kararlarının ayrıca yasal hiçbir zemini de yoktur. Şöyle ki;
  1. YASAL OLARAK:
  1. a) Davacı iddia ve beyan eder ki, PCR test kitleri ile Covid-19 virüsünün tespit edileceğine ve/veya edilmesi gerektiğine dair yasal herhangi bir zorunluluk yoktur ve/veya PCR testinin uygulanacağına ve/veya uygulanmasının zorunlu olacağına dair icbar mümkün değildir ve yasada da düzenlenmiş değildir. Her halukarda 45/2018 sayılı yasaya göre bir kimsenin muayene edilebilmesi için Mahkeme emri dahi aranmaktadır.

Her halukarda Virüsler kan testleri ve sair testlerle ve/veya antijen testleri ile de tespit edilebilecekleri gibi PCR, sürüntü testlerinin yasal olarak yer almaması nedeni ile kullanılmaya mecbur bırakılmasına dair alınmış karar ve/veya kararlar ve bu kararlar nedeni ile yapılan işlemler hatalıdırlar.

b)Davacı iddia ve beyan eder ki, 45/2018 sayılı yasa muayene edilmek hususunda zorunluluk getirmemektedir. Dolayısı ile PCR testleri ile sağlıklı olup olunmadığına dair muayene işlemi zorlanamaz ve/veya zorunlu olarak PCR testleri yapmak hususunda icbar edinilemez. Dolayısı ile Davalıların müştereken ve/veya münferiden PCR testleri ile hastalığın ve/veya Covid-19 virüsünün tespit edilmesi için muayene maksatlı PCR testi yapılmasına dair almış oldukları kararlar hatalıdır.

  1. BİLİMSEL VE/VEYA TIBBİ OLARAK:

a)PCR Testlerinin amacı Virüs Tespit etmek değilidir.

Davacı iddia eder ki, PCR sürüntü testleri genetik hastalıklar ve/veya prenetal tanı, adli tıp, kanser araştırmaları, babalık testleri, DNA analizi gibi analizlerin yapılması için yapılmıştır.

b)Yanlış pozitif çıkarabilir.

PCR Testleri spesifik ve güvenli testler değidir. PCR Testlerinin döngü sayısı DSÖ tarafından 14 Aralık 2020 ve  20 Ocak 2021 tarihinde de Başkan Tedors Adhanom Ghebreyesus’un daha önce kabul edilen  45 döngünün fazla pozitif  bulduğundan aşağı çekilmesi istenmiştir.

Yine alınan numunede başka virüs RNA/DNA’sının olması halinde (Influenza virüsü gibi), bunların döngüye girip kopyalanma ihtimali ve boyamada yanlış pozitif çıkma ihtimali vardır.

c)Davacı iddia eder ki, SARS-CoV2 virüsü izole edilmemiş olduğundan ve DSÖ’nün kabul ettiği (17 Ocak 2020) protokolde bu durum açıkça yazılmış olmasına rağmen test sonuçlarının doğruluk oranını saptamak için kullanılabilecek bir altın standart yoktur, olamazda. O nedenle bu testlerde elde edilecek sonuçlar tümüyle geçersizdir.

Ahar surette;

d)Virüs izolasyonu olduğu kabul edilse bile kullanımda mevcut sürüntü testlerinin hiçbirinin resmi verifikasyon ve validasyonu yoktur ve/veya ruhsatsızdır.

e)Cihazların %99’unda hangi gen diziliminin olduğu bilinmemektedir ve/veya sürüntü testlerinin birçoğunda, taşıdıkları gen dizilimleri (sekansları) deklare edilmiş ve/veya açıklanmış değil.

f)PCR testinin tekrar sayısına göre ölü virüsün geninin de çoğaltılarak, virüs aktifmiş gibi PCR pozitif sonucunu verebilir ancak bu aktif bir enfeksiyonun kanıtı değildir.

g)PCR testleri döngü sayısı göre %63-65 arası pozitif  yakalamaktadır. Sırf bu nedenle dahi güvenilir değildir.

h)PCR testleri sonuçlarını bilimsel olarak zayıf pozitif şeklinde vermez. Oysa bu mümkündür ancak PCR testi buna fırsat tanımaz ve PCR pozitif gösterir.

ı)E, N ve RdRp2 geninin herhangi birinin varlığı halinde yeterli pozitiflik kabul edildiğinden pozitif sayısı fazla görünmektedir. Oysa bu Nisan 2020 tarihine kadar her üç genin de aranması yönünde idi.

i)Virüsün mutasyona uğruyorsa, önceden hazırlanan test kitleri ile bugün mevcut virüsü aramak mantık dışıdır. Yine virüs her ülke ve coğrafyaya göre değişiklik gösterdiği iddia edildiğinden bu test kitleri geçersiz sayılmalıdır.

j)Gen dizilimi için model olarak kullanılan patojenik sıvılarda ne bir virüs titrasyonu ne de kuantifikasyonu yapılmış olduğundan, buradan, o sıvılar dahilinde milyarlarca virüs benzeri partikülün (insan organizmasında doğal olarak bulunan ve patojenik özellik taşımayan ekstraselüler veziküller dahil) bulunduğu anlaşılabilir.

k)Esas itibariyle, farinjiyal veya nazal COVID-19 sürüntü testlerinin hiçbir diyagnostik   değeri bulunmamaktadır.

l)PCR testleri burun içerisine nazofarenks denilen bölgeye kadar inmekte ve sürüntü bu bölgeden alınmaktadır. PCR testleri üzerinde mevcut herhangi bir bakteri bu bölgeye sürüntü testi ile aktarıldığı taktirde kişinin hastalanmasına yol açmaktadır. Dolayısı ile işlemin yapılışı açısından da hatalı ve/veya risklidir.

            C)BİREYSEL OLARAK:

Davacı iddia eder ki, PCR testlerinin üretilmesinin temel amacı virüs tespiti değil, DNA analizidir. Her halukarda PCR testlerinin nasıl imha edildiği belli olmamakla birlikte bir toplumun da DNA örnekleri alınmaktadır. Dolayısı ile aynı zamanda etik de değildir ve/veya kimsenin DNA’sı zorlanmak sureti ile ve/veya alınacak kararlarla ve/veya rızası dışında da temin edilmemelidir. Nitekim Davalıların müştereken ve/veya münferiden almış olduğu kararlar Davacının DNA’sının da alınması neticesini doğuracaktır ki, Davacının buna rızası yoktur.

  1. Davacı iddia ve beyan eder ki, Davalıların müştereken ve/veya münferiden almış oldukları kararlar nedeni ile ve/veya 15 günde bir yenilenmek kaydı ile PCR testi yaptırtmak ile ilgili kararları neticesinde Davacının çalışma hakkı da etkilenmektedir. Davacı PCR testi olmaksızın çalışamama ihtimali ve dolayısı ile kendisini ekonomik olarak geliştirememe ihtimali taşımaktadır ki yasal dayanağı olmayan bir test ile Davacının Anayasal hakları etkilenecektir. Yine bu test ile hatalı pozitif olma ihtimali söz konusu olabilir. Bir kimsenin pozitif çıkması ile kişi Anayasaya aykırı bir şekilde kişi özgürlüğünden yoksun bırakılarak Karantina otellerine yerleştirilmekte ve kendisine derhal tıbbi tedavi uygulanmaya başlanmaktadır. Her halukarda uygulanan tedavinin tedavi protokolü dahi bulunmamaktadır ve/veya Davalı No.2 ve/veya No.3’ün uyguladığı tedavi PCR pozitif olup, gerek hatalı, gerekse gerçek pozitif olan kimselerde ciddi sağlık sorunlarına yol açmaktadır ve/veya Davalı No.2 ve/veya No.3 ve/veya Davalılar müştereken ve/veya münferdien PCR pozitif kimselere hatalı ve/veya yanlış ve/veya gereksiz tedavi de uygulayabilmektedirler. Dolayısı ile muhtemel bir hatalı pozitif, yukarıdaki iddialara halel gelmeksizin bir kişinin temel hak ve özgürlüklerini sınırlayacağı gibi ve/veya kişi özgürlüğünü sınırlayacağı gibi, ülke içerisinde gereksiz önlemlerin alınmasına sebebiyet vermek sureti ile Anayasa’da yer alan birçok kişi hak ve özgürlüklerinden men edilmesini sağlayacak tedbirler alınması sağlanacak ve/veya kişilerin ve/veya spesifik olarak Davacının Çalışma Hakkı, Hayat ve vücut bütünlüğü hakkı, sağlıklı yaşama hakkı ve/veya sağlık hakkı gibi hakları da etkilenecektir.

7.Davacı iddia ve beyan eder ki, Davalının yapmış olduğu işlemlerin ve/veya almış oldukları kararlarda ve bu konuda verilmiş olan karar ve/veya yapılmış olan işlem ve/veya eylem ve/veya ihmal tamamen hatalıdır ve/veya yanlıştır. Bu karar ve/veya kararlar Davacıyı zarar ve ziyanlara düçar bırakmakta ve mağdur etmektedir ve dolayısı ile işbu kararın iptal edilmesi gerekmektedir.

8.İşbu YİM konusu karar ve/veya işlemler nedeni ile Davacının işbu YİM davasını dosyalama mecburiyeti hasıl olmuştur ve/veya işbu kararların alınması ve/veya bu hususta yapılan işlemlerin ve/veya 27/02/2019 tarihli karar nedeni ile Davacının münferiden meşru menfaatleri etkilenmektedir ve işbu davayı dosyalamakta da meşru menfaati bulunmaktadır.

İşbu dava Davacı Avukatı Boysan Boyra tarafından tanzim edilmiştir.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa’dır.

                                                              Boysan Boyra

                                                      Davacı Tarafından Avukat

………/….03…../2021 tarihinde

kaydolunup mühürlenmiştir.

                                      Mukayyit.

Not: Bu davaya verilecek bir müdafaanın davanın tebliğ tarihinden itibaren yirmi bir (21) gün zarfında kayıt kalemine bizzat veya Avukat vasıtasıyle verilir ve bir sureti davacıların tebliğ adresine bırakılır.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

                Başsavcılığı  Lefkoşa, KKTC.

                                                                                                          ARASINDA.

                                                                                  

Yukarıdaki Müstedi tarafından yapılmış tek taraflı istida:

Yukarıdaki Müstedi işbu istidası ile;

  1. Esas başvurunun nihai bir karara bağlanmasına ve/veya Muhterem Mahkeme’ce takdir ve tayin edilecek bir tarihe kadar; Davalılar tarafından müştereken ve/veya münferiden takriben ve/veya 27/02/2021 tarihinde alınan ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararın icraasını men edici bir emir ve/veya geçici bir ara emri verilmesi ve/veya yürütmenin durdurulmasına dair bir emir verilmesi zımnında bir Mahkeme emri itası;
  1. Muhterem mahkemece uygun görülecek başka bir emir ve/veya çare.
  1. Bu istida masraflarının M/aleyhlere tahmili.

 için gerekli emrin isdarını talep eder.

İşbu başvuru KKTC. Anayasa’sının 152, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere ve Yüksek Mahkeme Tüzüğüne istinad eder.

Bu istidada istinad edilen gerçekler Lefkoşa   sakinlerinden Seda Okgül’ün  ilişikte sunulan  yemin varakasında gösterilmektedir.

 

Bu istida Müstedinin Avukatı Boysan Boyra tarafından yapılmıştır.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı altı, Lefkoşa’dır.

                                                                                                          Boysan Boyra

                                                                                              Müstedi Tarafından Avukat.

2021  senesinin Mart  ayının   2. günü

dosyalanmıştır. Dinlenmesi için  2021 senesi

Mart ayının …………..gününe tayin edilmiştir.                 

                                                                                                                                                                    Mukayyit.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

3.Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle                   Başsavcılık  Lefkoşa.

                                                                                                          ARASINDA.

                                                                           

 

                                                        YEMİN BELGESİ

Ben aşağıda imza sahibi Lefkoşa  sakinlerinden Seda Okgül , yemin eder ve bu yeminimle aşağıda gösterilen hususları beyan ederim.

  1. Yukarıda unvan ve sayısı gösterilen başvuruda davacı ve işbu istidada ise  Müstediyim.
  1. Bu istida maksatları bakımından esas başvurumdaki tüm iddiaları burada aynen tekrarlar ve benimserim.
  1. DSÖ tarafından ilan edilen pandemi nedeni ile Covid-19 virüsünün tespiti bir nevi PCR testlerine bağlanmıştır. Oysa ki PCR testleri dışında başka alternatif testler vardır. Mesela kan testleri ve sair testler uygulanarak virüsler tespit edilebilir. Davamda da açık olarak belirtmiş olduğum gibi, PCR testleri ciddi hatalar vermektedir. Her halukarda özetle;

Bu testlerin yasal dayanağı yoktur. Herhangi bir kimsenin bir başka kimseyi Bulaşıcı Hastalıklar yasası Tahtında muayene edebilmesi için Mahkeme emrine ihtiyaç duyması gerekmekte iken, Davalı/M/aleyhler yasa dışı bir şekilde ve/veya Almış oldukları ve yayınladıkları kararlar ile zorunlu olarak PCR testi yaptırtmak surety ile muayeneye tabi tutmaya çalışmaktadırlar. Ancak az önce bahsettiğim üzere bunu yapabilmek ilgili yasada Mahkeme ermine bağlanmışken, Davalılar yetki aşımı yapmak suretiyle ve icbar ederek, PCR testi vasıtası ile Covid-19 virüsünü tespit etmeye çalışmaktadırlar. Her halukarda mezkur muayeneyi hasta oluğundan şüphelenilen kişiler yerine sağlıklı kişiler üzerinde yapmaktadırlar ki, bu test ve alınan kararlar amacı aşmaktadır.

Yine mezkur testler birçok sebeple hatalı sonuç vermektedirler. Herhangi bir virüsün varlığı ve/veya ölü bir virus varlığı dahi, PCR testlerinin döngüsünde çoğaltılmakta ve aşırı çoğaltmada (-ki döngü sayısı değiştirilmiş olmasına rağmen) Davalılar PCR testlerinin ve/veya ilk nazarda DSÖ nün Kabul edip daha sonra değiştirdiği döngü sayısını uygulamakta ısrar etmekte ve hatalı pozitifler yaratmaktadırlar.

Bir diğer önemli husus ise mezkur testler sürüntü testleri olup, bu testler burun ve akabinde boğaza sürüntü yapılarak yani, tükürük de alınarak yapılmaktadır. İddia ederim ki, PCR testleri DNA analizleri yapmak için kullanılan test türleridir. Davalılar müştereken ve/veya münferiden kararlar almak suretiyle şahsıma ait DNA analizlerini çıkarabileceklerdir. Ancak böyle bir hususa rızam yoktur. Böyle birşey bedenime ait olan anahtarın tümü ile Davalıların eline geçmesine neden olacağından, bedenimin tüm zayıflıklarını tespit edebilme ihtimaline de yol açacaktır. Kaldı ki, mezkur testlerin imha edilip edilmediği, ve/veya nasıl ve ne şekilde imha edildiği belli değildir, hiç açıklanmamıştır. Şahsen bu husus beni ayrıca rahatsız etmektedir.  Kendi bedenim ve sağlığım üzerinde söz hakkım bulunmakta olduğuna inanmaktayım.

  1. İddia ve beyan ederim ki, Davalıların bu kararı aynı zamanda Anayasa ile korunma altına alınan kişi hak ve özgürlüklerin özüne dokunmaktadır.
  1. Her halukarda Davalıların baz aldığı bu PCR testleri ifade etmiş olduğum gibi hatalı pozitif vermekte ve/veya bir kimse önce pozitif, sonra negatif veya döngüye göre pozitif vermektedir. Herhangi bir şekilde hatalı pozitif temin edilmesi halinde,  Anayasaya aykırı olduğunu düşündüğüm karantina otellerine kapatılarak tedavi edilmem sonucunu dahi doğurabilecektir ki, Davalı No.2’nin uyguladığı sağlık protokolleri belirsizdir ve/veya yanlış uygulamalar olduğu duyumlarını almaktayım .
  1. Yukarda yer alan tüm nedenlerle  ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar inancım odur ki, yoklukla malul bir karardır ve/veya hatalıdır ve bu nedenle de hükümsüz ve/veya etki doğurmaması gereken bir karardır ve işbu nedenle de iptal edilmesi gerekmektedir.
  1. İddia ve beyan ederim ki, Davalıların almış olduğu karar ve/veya işbu karar doğrultusunda yapılan işlemler, açıkça kanuna aykırıdır. Hatta kanuni değildir ve yasal dayanağı yoktur.
  1. Yine,  iddia ve beyan ederim ki, karara bağlanması gereken kony ciddidir ve iddialarımda haklı olduğuma dair belirtiler mevcuttur, keza ara emri verilmez ise ileride telafisi mümkün olmayacak bir zararın doğması mümkündür. Mesela mezkur karar çalışma hakkımı engellemekte, hatalı bir netice de ortaya koyabileceği ve tedavi görmeme neden olabileceği gibi, DNA mın temin edilmesine de neden olacaktır. Kaldı ki, alınan kararlar gereği PCR testi yaptırmış değilim ve yaptırmak konusunda da rızam yoktur ve/veya yaptırmak zorunda olmadığıma da inanmaktayım. 
  1. Yukarıdakiler gereğince karara bağlanması gereken konunun çok ciddi ve acil olduğu inancındayım ve davanın adilane bir şekilde kararlaştırılabilmesi için böyle bir emrin verilmesine ihtiyaç olduğuna inanmaktayım.
  1. Tüm yukarıda iddia etmiş olduğum sebeplerle bu  istida ile talep edilen emrin verilmemesi halinde ileride telafisi imkansız zarar ziyana uğramam söz konusu olacak, geriye dönüş imkansızlaşacaktır ve/veya çok zorlaşacağına inanmaktayım.
  2. Yukarıda gerçekler ışığında istida da olduğu gibi emir verilmesinin adil ve hakkaniyete uygun olduğu inancı ile bu doğrultuda talepte bulunurum.

                                                                      Yemin eden

                                                           ……………………………………

Seda Okgül  

2021Yılı Mart ayının 2..günü

yemin ve imza edilmiştir.                   Mukayyit.         

 

 

https://www.habervakti.com/gundem/korona-nin-dayandigi-temel-cokebilir-pcr-testi-kibris-ta-h137719.html

https://www.5gvirusnews.com/hukuk/pcr-dunyada-ilk-kez-kktcde-yargilanacak-h484.html

 

 

[/et_pb_text][/et_pb_column][/et_pb_row][/et_pb_section]DSÖ’nün 17 Ocak 2020 tarihinde kabul ettiği PCR tanı kiti ile COVİD-19’u dünyaya yaydıktan sonra, 12 Mart 2020 tarihinde ilan ettiği pandeminin bütün şifreleri çözüldü. İşte çözülen bu şifrelerin başında, DSÖ’nün PCR test kiti protoklünü kabul ettiği Berlin Charite Viroloji Enstitüsü Prof. Direktörü Christian Drosten’in yazdığı makalede, Virüs İZOLATLARI ile ilgili elinde materyal olmadığını itiraf etmesi vardı. Dava da izole edilmemiş virus ile var edilen PCR tanı kitiyle test yapılmasına karşı açıldı.

Açılan davada COVİD-19 virüsünün İZOLATLARI, yani enfekte olmuş bir kişiden veya doğal ortamdan elde edilmiş, laboratuvar kökenli olmayan, mikrobiyal veya viral anlamda saf bir numune olmadığı halde, PCR tanı kiti ile pozitif sonuç tespit edilerek vaka sayısı oluşturulduğu belgelendi.

Dava metninde dünyanın her yerinde olduğu gibi KKTC’de ne işe yaradığı belli olmayan PCR test kiti ile insanların bedenine müdahale edildiği ve bunun da yasalarda yer olmadığı yer aldı.

Daha önce Portekiz de 11 Kasım 2020 tarihinde açılan bir davada mahkeme, PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin karar verdi. 23 Kasım 2020 tarihinde ise Berlin’de PCR tanı kitini DSÖ’ye kabul ettiren Christian Drosten’in sahte salgına neden olduğu için hakkında dava açıldı. Bunun üzerien DSÖ, 14 Aralık 2020 ve 20 Ocak 2021 tarihinde PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin açıklama yaptı.

Dünya’da Seda OKGÜL’ün KKTC Yüksek İdare Mahkemesi’nde açtığı davada PCR tanı kiti ilk kez yargılanıyor..

 

 

DAVA METNİ

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.

                                                                                                                      YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

 

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

   Başsavcılığı, Lefkoşa.

                                                                                                           Arasında

Yukarıdaki Davacı Tarafından

TALEP TAKRİRİ

Malumunuz olsun ki, yukarıda adı yazılı davacı aşağıdaki çareler için Mahkemeye başvurur;

Şöyle ki;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının  hükümsüz ve/veya etkisiz ve/veya herhangi bir sonuç doğurmayacağına dair karar verilmesini;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup , açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının bir ihmal olduğuna ve/veya böyle bir ihmalin yapılmaması gereken bir ihmal olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının iptal edilmesi gereken bir karar olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar yoklukla  maluldur  ve/veya mutlak butlanla sakattır  dolayısı ile mezkur karar etkisiz,  hükümsüz ve/veya herhangi bir sonuç doğurmayacak bir karardır ve dolayısı ile iptal edilmesi gereken bir karar olduğu hususunda bir emir.

İşbu dava masraflarıdır.

İşbu dava KKTC Anayasasının 152. Maddesine, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere istinad eder.

Bu Dava Aşağıdaki Hukuki Esaslara Dayanır:

  1. Davalı dava konusu kararı değerlendirirken ve/veya dava konusu kararı alırken  ihmalde bulundu. Keza davacının haklarını ihlal etmekte ve/veya davacıyı mağdur etmektedir.
  1. Davalının, Dava konusu karar ve/veya işlemleri ve/veya eylemleri Anayasaya ilgili mevzuata ve/veya Doğal Aalet ilkelerine ve/veya Hak ve Nisfet Hukuku kaidelerine aykırı ve/veya gayrı yasaldır ve/veya hükümsüzür.
  1. Davalı 27/02/2021 tarihli kararı istihsal ederken ve/veya ve/veya değerlendirme yaparken ilgili mevzuatı yanlış anlamış ve/veya hatalı uygulamış ve/veya eksik uygulamışdır.
  1. Dava konusu karar ve/veya işlem ve/veya işlemler gerekçeden yoksundur ve/veya keyfidir ve/veya hatalı değerlendirmelere dayanmaktadır ve/veya yasal dayanağı yoktur ve/veya kanunilik ilkesine aykırı bir şekilde karar alınmıştır.  
  1. Davalı, Dava konusu kararı alıırken ve/veya işlemleri yaparken  yeterli inceleme ve/veya araştırma yapmadı  ve/veya eksik ve/veya  hatalı inceleme yaptı . Ayni nedenle bunlar neticesinde  hatalı kararlar istihsal etti ve/veya  işlemler yaptı .
  1. Dava konusu karar alınırken ve/veya işlemler yapılırken davalı yetkilerini aştı  ve/veya yetkisiz olarak karar aldı  ve/veya yetki aşımı ile kararlar aldı ve/veya bu kararlar doğrultusunda işlemler yaptı  ve/veya yetkilerini kötüye kullandı  ve  dava konusu kararları bu suretle istihsal etti.

Bu Davayı Desteklemek İçin Aşağıdaki Olgulara Dayanılır:

  1. Davacı Lefkoşa’da ikamet etmekte olup, takriben ve/veya 19 yıldır Avukatlık mesleği ile iştigal etmektedir.
  1. Davalı No.1, KKTC Bakanlar Kurulu olup, yönetsel faaliyetlerde bulunan ve/veya genel siyaseti belirlemekte ve/veya yasa gücünde kararname çıkarmakta ve/veya Anayasa’da belirtilmiş ve/veya sayılmış görevleri yerine getirmektedir. Davalı No.2 KKTC Sağlık Bakanlığı Anayasanın 45. Maddesi gereğince “herkesin beden ve ruh sağlığı içinde yaşayabilmesini ve tıbbi bakım görmesini sağlama ödevi olan yürütsel ve yönetsel yetki kullanan bir organ ve/veya  makam ve/veya Bakanlıktır ve/veya kamu tüzel kişiliğine haizdir. Davalı No.3 Davalı No.2’ye bağlı olarak faaliyet göstermekte ve/veya 45/2018 sayılı Bulaşıcı Hastalıklar Yasası kapsamında kurulan bir kurul ve/veya komitedir.
  1. Takriben ve/veya 2019 yılı sonlarında Çin’de başladığı iddia olunan ve daha sonra dünya genelinde 17 Ocak 2020 tarihinde DSÖ tararından kabul edilen PCR tanı kiti ile  Şubat 2020 yılı itibarı ile dünya genelinde görülmeye başlamış ve Covid-19 olarak isimlendirilmiş ve/veya 12/03/2020  tarihinde de Dünya Sağlık Örgütü tarafından pandemi ilan edilmiştir. Bunun üzerine tüm devletler toplum sağlığı iddiası ile önlem almışlar ve/veya zaman zaman da bu önlem ve/veya tedbirlerini değiştirmek ve/veya sürece uydurmak adına da farklı önlemler almışlar ve/veya Anayasa’da yer alan kişi hak ve özgürlüklerini kısıtlamak sureti ile de önlem ve/veya tedbirlerini değiştirmişlerdir.  
  1. Bu süre içerisinde ve/veya dünya genelinde Covid-19 olarak isimlendirilen virüs sonucu DSÖ tarafından ilan edilen pandemi, PCR testi için boğaz ve burundan sürüntü örneği alınarak tespit edilmeye çalışılmıştır.
  1. Davacı iddia ve beyan eder ki; süreç içerisinde yapılan çalışmalar ve/veya tıbbi çalışmalar ve/veya gözlemler neticesinde PCR olarak adlandırılan test kitlerinin kullanılması doğru değildir ve/veya hatalıdır. Davalıların bu konudaki kararlarının ayrıca yasal hiçbir zemini de yoktur. Şöyle ki;
  1. YASAL OLARAK:
  1. a) Davacı iddia ve beyan eder ki, PCR test kitleri ile Covid-19 virüsünün tespit edileceğine ve/veya edilmesi gerektiğine dair yasal herhangi bir zorunluluk yoktur ve/veya PCR testinin uygulanacağına ve/veya uygulanmasının zorunlu olacağına dair icbar mümkün değildir ve yasada da düzenlenmiş değildir. Her halukarda 45/2018 sayılı yasaya göre bir kimsenin muayene edilebilmesi için Mahkeme emri dahi aranmaktadır.

Her halukarda Virüsler kan testleri ve sair testlerle ve/veya antijen testleri ile de tespit edilebilecekleri gibi PCR, sürüntü testlerinin yasal olarak yer almaması nedeni ile kullanılmaya mecbur bırakılmasına dair alınmış karar ve/veya kararlar ve bu kararlar nedeni ile yapılan işlemler hatalıdırlar.

b)Davacı iddia ve beyan eder ki, 45/2018 sayılı yasa muayene edilmek hususunda zorunluluk getirmemektedir. Dolayısı ile PCR testleri ile sağlıklı olup olunmadığına dair muayene işlemi zorlanamaz ve/veya zorunlu olarak PCR testleri yapmak hususunda icbar edinilemez. Dolayısı ile Davalıların müştereken ve/veya münferiden PCR testleri ile hastalığın ve/veya Covid-19 virüsünün tespit edilmesi için muayene maksatlı PCR testi yapılmasına dair almış oldukları kararlar hatalıdır.

  1. BİLİMSEL VE/VEYA TIBBİ OLARAK:

a)PCR Testlerinin amacı Virüs Tespit etmek değilidir.

Davacı iddia eder ki, PCR sürüntü testleri genetik hastalıklar ve/veya prenetal tanı, adli tıp, kanser araştırmaları, babalık testleri, DNA analizi gibi analizlerin yapılması için yapılmıştır.

b)Yanlış pozitif çıkarabilir.

PCR Testleri spesifik ve güvenli testler değidir. PCR Testlerinin döngü sayısı DSÖ tarafından 14 Aralık 2020 ve  20 Ocak 2021 tarihinde de Başkan Tedors Adhanom Ghebreyesus’un daha önce kabul edilen  45 döngünün fazla pozitif  bulduğundan aşağı çekilmesi istenmiştir.

Yine alınan numunede başka virüs RNA/DNA’sının olması halinde (Influenza virüsü gibi), bunların döngüye girip kopyalanma ihtimali ve boyamada yanlış pozitif çıkma ihtimali vardır.

c)Davacı iddia eder ki, SARS-CoV2 virüsü izole edilmemiş olduğundan ve DSÖ’nün kabul ettiği (17 Ocak 2020) protokolde bu durum açıkça yazılmış olmasına rağmen test sonuçlarının doğruluk oranını saptamak için kullanılabilecek bir altın standart yoktur, olamazda. O nedenle bu testlerde elde edilecek sonuçlar tümüyle geçersizdir.

Ahar surette;

d)Virüs izolasyonu olduğu kabul edilse bile kullanımda mevcut sürüntü testlerinin hiçbirinin resmi verifikasyon ve validasyonu yoktur ve/veya ruhsatsızdır.

e)Cihazların %99’unda hangi gen diziliminin olduğu bilinmemektedir ve/veya sürüntü testlerinin birçoğunda, taşıdıkları gen dizilimleri (sekansları) deklare edilmiş ve/veya açıklanmış değil.

f)PCR testinin tekrar sayısına göre ölü virüsün geninin de çoğaltılarak, virüs aktifmiş gibi PCR pozitif sonucunu verebilir ancak bu aktif bir enfeksiyonun kanıtı değildir.

g)PCR testleri döngü sayısı göre %63-65 arası pozitif  yakalamaktadır. Sırf bu nedenle dahi güvenilir değildir.

h)PCR testleri sonuçlarını bilimsel olarak zayıf pozitif şeklinde vermez. Oysa bu mümkündür ancak PCR testi buna fırsat tanımaz ve PCR pozitif gösterir.

ı)E, N ve RdRp2 geninin herhangi birinin varlığı halinde yeterli pozitiflik kabul edildiğinden pozitif sayısı fazla görünmektedir. Oysa bu Nisan 2020 tarihine kadar her üç genin de aranması yönünde idi.

i)Virüsün mutasyona uğruyorsa, önceden hazırlanan test kitleri ile bugün mevcut virüsü aramak mantık dışıdır. Yine virüs her ülke ve coğrafyaya göre değişiklik gösterdiği iddia edildiğinden bu test kitleri geçersiz sayılmalıdır.

j)Gen dizilimi için model olarak kullanılan patojenik sıvılarda ne bir virüs titrasyonu ne de kuantifikasyonu yapılmış olduğundan, buradan, o sıvılar dahilinde milyarlarca virüs benzeri partikülün (insan organizmasında doğal olarak bulunan ve patojenik özellik taşımayan ekstraselüler veziküller dahil) bulunduğu anlaşılabilir.

k)Esas itibariyle, farinjiyal veya nazal COVID-19 sürüntü testlerinin hiçbir diyagnostik   değeri bulunmamaktadır.

l)PCR testleri burun içerisine nazofarenks denilen bölgeye kadar inmekte ve sürüntü bu bölgeden alınmaktadır. PCR testleri üzerinde mevcut herhangi bir bakteri bu bölgeye sürüntü testi ile aktarıldığı taktirde kişinin hastalanmasına yol açmaktadır. Dolayısı ile işlemin yapılışı açısından da hatalı ve/veya risklidir.

            C)BİREYSEL OLARAK:

Davacı iddia eder ki, PCR testlerinin üretilmesinin temel amacı virüs tespiti değil, DNA analizidir. Her halukarda PCR testlerinin nasıl imha edildiği belli olmamakla birlikte bir toplumun da DNA örnekleri alınmaktadır. Dolayısı ile aynı zamanda etik de değildir ve/veya kimsenin DNA’sı zorlanmak sureti ile ve/veya alınacak kararlarla ve/veya rızası dışında da temin edilmemelidir. Nitekim Davalıların müştereken ve/veya münferiden almış olduğu kararlar Davacının DNA’sının da alınması neticesini doğuracaktır ki, Davacının buna rızası yoktur.

  1. Davacı iddia ve beyan eder ki, Davalıların müştereken ve/veya münferiden almış oldukları kararlar nedeni ile ve/veya 15 günde bir yenilenmek kaydı ile PCR testi yaptırtmak ile ilgili kararları neticesinde Davacının çalışma hakkı da etkilenmektedir. Davacı PCR testi olmaksızın çalışamama ihtimali ve dolayısı ile kendisini ekonomik olarak geliştirememe ihtimali taşımaktadır ki yasal dayanağı olmayan bir test ile Davacının Anayasal hakları etkilenecektir. Yine bu test ile hatalı pozitif olma ihtimali söz konusu olabilir. Bir kimsenin pozitif çıkması ile kişi Anayasaya aykırı bir şekilde kişi özgürlüğünden yoksun bırakılarak Karantina otellerine yerleştirilmekte ve kendisine derhal tıbbi tedavi uygulanmaya başlanmaktadır. Her halukarda uygulanan tedavinin tedavi protokolü dahi bulunmamaktadır ve/veya Davalı No.2 ve/veya No.3’ün uyguladığı tedavi PCR pozitif olup, gerek hatalı, gerekse gerçek pozitif olan kimselerde ciddi sağlık sorunlarına yol açmaktadır ve/veya Davalı No.2 ve/veya No.3 ve/veya Davalılar müştereken ve/veya münferdien PCR pozitif kimselere hatalı ve/veya yanlış ve/veya gereksiz tedavi de uygulayabilmektedirler. Dolayısı ile muhtemel bir hatalı pozitif, yukarıdaki iddialara halel gelmeksizin bir kişinin temel hak ve özgürlüklerini sınırlayacağı gibi ve/veya kişi özgürlüğünü sınırlayacağı gibi, ülke içerisinde gereksiz önlemlerin alınmasına sebebiyet vermek sureti ile Anayasa’da yer alan birçok kişi hak ve özgürlüklerinden men edilmesini sağlayacak tedbirler alınması sağlanacak ve/veya kişilerin ve/veya spesifik olarak Davacının Çalışma Hakkı, Hayat ve vücut bütünlüğü hakkı, sağlıklı yaşama hakkı ve/veya sağlık hakkı gibi hakları da etkilenecektir.

7.Davacı iddia ve beyan eder ki, Davalının yapmış olduğu işlemlerin ve/veya almış oldukları kararlarda ve bu konuda verilmiş olan karar ve/veya yapılmış olan işlem ve/veya eylem ve/veya ihmal tamamen hatalıdır ve/veya yanlıştır. Bu karar ve/veya kararlar Davacıyı zarar ve ziyanlara düçar bırakmakta ve mağdur etmektedir ve dolayısı ile işbu kararın iptal edilmesi gerekmektedir.

8.İşbu YİM konusu karar ve/veya işlemler nedeni ile Davacının işbu YİM davasını dosyalama mecburiyeti hasıl olmuştur ve/veya işbu kararların alınması ve/veya bu hususta yapılan işlemlerin ve/veya 27/02/2019 tarihli karar nedeni ile Davacının münferiden meşru menfaatleri etkilenmektedir ve işbu davayı dosyalamakta da meşru menfaati bulunmaktadır.

İşbu dava Davacı Avukatı Boysan Boyra tarafından tanzim edilmiştir.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa’dır.

                                                              Boysan Boyra

                                                      Davacı Tarafından Avukat

………/….03…../2021 tarihinde

kaydolunup mühürlenmiştir.

                                      Mukayyit.

Not: Bu davaya verilecek bir müdafaanın davanın tebliğ tarihinden itibaren yirmi bir (21) gün zarfında kayıt kalemine bizzat veya Avukat vasıtasıyle verilir ve bir sureti davacıların tebliğ adresine bırakılır.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

                Başsavcılığı  Lefkoşa, KKTC.

                                                                                                          ARASINDA.

                                                                                  

Yukarıdaki Müstedi tarafından yapılmış tek taraflı istida:

Yukarıdaki Müstedi işbu istidası ile;

  1. Esas başvurunun nihai bir karara bağlanmasına ve/veya Muhterem Mahkeme’ce takdir ve tayin edilecek bir tarihe kadar; Davalılar tarafından müştereken ve/veya münferiden takriben ve/veya 27/02/2021 tarihinde alınan ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararın icraasını men edici bir emir ve/veya geçici bir ara emri verilmesi ve/veya yürütmenin durdurulmasına dair bir emir verilmesi zımnında bir Mahkeme emri itası;
  1. Muhterem mahkemece uygun görülecek başka bir emir ve/veya çare.
  1. Bu istida masraflarının M/aleyhlere tahmili.

 için gerekli emrin isdarını talep eder.

İşbu başvuru KKTC. Anayasa’sının 152, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere ve Yüksek Mahkeme Tüzüğüne istinad eder.

Bu istidada istinad edilen gerçekler Lefkoşa   sakinlerinden Seda Okgül’ün  ilişikte sunulan  yemin varakasında gösterilmektedir.

 

Bu istida Müstedinin Avukatı Boysan Boyra tarafından yapılmıştır.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı altı, Lefkoşa’dır.

                                                                                                          Boysan Boyra

                                                                                              Müstedi Tarafından Avukat.

2021  senesinin Mart  ayının   2. günü

dosyalanmıştır. Dinlenmesi için  2021 senesi

Mart ayının …………..gününe tayin edilmiştir.                 

                                                                                                                                                                    Mukayyit.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

3.Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle                   Başsavcılık  Lefkoşa.

                                                                                                          ARASINDA.

                                                                           

 

                                                        YEMİN BELGESİ

Ben aşağıda imza sahibi Lefkoşa  sakinlerinden Seda Okgül , yemin eder ve bu yeminimle aşağıda gösterilen hususları beyan ederim.

  1. Yukarıda unvan ve sayısı gösterilen başvuruda davacı ve işbu istidada ise  Müstediyim.
  1. Bu istida maksatları bakımından esas başvurumdaki tüm iddiaları burada aynen tekrarlar ve benimserim.
  1. DSÖ tarafından ilan edilen pandemi nedeni ile Covid-19 virüsünün tespiti bir nevi PCR testlerine bağlanmıştır. Oysa ki PCR testleri dışında başka alternatif testler vardır. Mesela kan testleri ve sair testler uygulanarak virüsler tespit edilebilir. Davamda da açık olarak belirtmiş olduğum gibi, PCR testleri ciddi hatalar vermektedir. Her halukarda özetle;

Bu testlerin yasal dayanağı yoktur. Herhangi bir kimsenin bir başka kimseyi Bulaşıcı Hastalıklar yasası Tahtında muayene edebilmesi için Mahkeme emrine ihtiyaç duyması gerekmekte iken, Davalı/M/aleyhler yasa dışı bir şekilde ve/veya Almış oldukları ve yayınladıkları kararlar ile zorunlu olarak PCR testi yaptırtmak surety ile muayeneye tabi tutmaya çalışmaktadırlar. Ancak az önce bahsettiğim üzere bunu yapabilmek ilgili yasada Mahkeme ermine bağlanmışken, Davalılar yetki aşımı yapmak suretiyle ve icbar ederek, PCR testi vasıtası ile Covid-19 virüsünü tespit etmeye çalışmaktadırlar. Her halukarda mezkur muayeneyi hasta oluğundan şüphelenilen kişiler yerine sağlıklı kişiler üzerinde yapmaktadırlar ki, bu test ve alınan kararlar amacı aşmaktadır.

Yine mezkur testler birçok sebeple hatalı sonuç vermektedirler. Herhangi bir virüsün varlığı ve/veya ölü bir virus varlığı dahi, PCR testlerinin döngüsünde çoğaltılmakta ve aşırı çoğaltmada (-ki döngü sayısı değiştirilmiş olmasına rağmen) Davalılar PCR testlerinin ve/veya ilk nazarda DSÖ nün Kabul edip daha sonra değiştirdiği döngü sayısını uygulamakta ısrar etmekte ve hatalı pozitifler yaratmaktadırlar.

Bir diğer önemli husus ise mezkur testler sürüntü testleri olup, bu testler burun ve akabinde boğaza sürüntü yapılarak yani, tükürük de alınarak yapılmaktadır. İddia ederim ki, PCR testleri DNA analizleri yapmak için kullanılan test türleridir. Davalılar müştereken ve/veya münferiden kararlar almak suretiyle şahsıma ait DNA analizlerini çıkarabileceklerdir. Ancak böyle bir hususa rızam yoktur. Böyle birşey bedenime ait olan anahtarın tümü ile Davalıların eline geçmesine neden olacağından, bedenimin tüm zayıflıklarını tespit edebilme ihtimaline de yol açacaktır. Kaldı ki, mezkur testlerin imha edilip edilmediği, ve/veya nasıl ve ne şekilde imha edildiği belli değildir, hiç açıklanmamıştır. Şahsen bu husus beni ayrıca rahatsız etmektedir.  Kendi bedenim ve sağlığım üzerinde söz hakkım bulunmakta olduğuna inanmaktayım.

  1. İddia ve beyan ederim ki, Davalıların bu kararı aynı zamanda Anayasa ile korunma altına alınan kişi hak ve özgürlüklerin özüne dokunmaktadır.
  1. Her halukarda Davalıların baz aldığı bu PCR testleri ifade etmiş olduğum gibi hatalı pozitif vermekte ve/veya bir kimse önce pozitif, sonra negatif veya döngüye göre pozitif vermektedir. Herhangi bir şekilde hatalı pozitif temin edilmesi halinde,  Anayasaya aykırı olduğunu düşündüğüm karantina otellerine kapatılarak tedavi edilmem sonucunu dahi doğurabilecektir ki, Davalı No.2’nin uyguladığı sağlık protokolleri belirsizdir ve/veya yanlış uygulamalar olduğu duyumlarını almaktayım .
  1. Yukarda yer alan tüm nedenlerle  ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar inancım odur ki, yoklukla malul bir karardır ve/veya hatalıdır ve bu nedenle de hükümsüz ve/veya etki doğurmaması gereken bir karardır ve işbu nedenle de iptal edilmesi gerekmektedir.
  1. İddia ve beyan ederim ki, Davalıların almış olduğu karar ve/veya işbu karar doğrultusunda yapılan işlemler, açıkça kanuna aykırıdır. Hatta kanuni değildir ve yasal dayanağı yoktur.
  1. Yine,  iddia ve beyan ederim ki, karara bağlanması gereken kony ciddidir ve iddialarımda haklı olduğuma dair belirtiler mevcuttur, keza ara emri verilmez ise ileride telafisi mümkün olmayacak bir zararın doğması mümkündür. Mesela mezkur karar çalışma hakkımı engellemekte, hatalı bir netice de ortaya koyabileceği ve tedavi görmeme neden olabileceği gibi, DNA mın temin edilmesine de neden olacaktır. Kaldı ki, alınan kararlar gereği PCR testi yaptırmış değilim ve yaptırmak konusunda da rızam yoktur ve/veya yaptırmak zorunda olmadığıma da inanmaktayım. 
  1. Yukarıdakiler gereğince karara bağlanması gereken konunun çok ciddi ve acil olduğu inancındayım ve davanın adilane bir şekilde kararlaştırılabilmesi için böyle bir emrin verilmesine ihtiyaç olduğuna inanmaktayım.
  1. Tüm yukarıda iddia etmiş olduğum sebeplerle bu  istida ile talep edilen emrin verilmemesi halinde ileride telafisi imkansız zarar ziyana uğramam söz konusu olacak, geriye dönüş imkansızlaşacaktır ve/veya çok zorlaşacağına inanmaktayım.
  2. Yukarıda gerçekler ışığında istida da olduğu gibi emir verilmesinin adil ve hakkaniyete uygun olduğu inancı ile bu doğrultuda talepte bulunurum.

                                                                      Yemin eden

                                                           ……………………………………

Seda Okgül  

2021Yılı Mart ayının 2..günü

yemin ve imza edilmiştir.                   Mukayyit.         

 

 

https://www.habervakti.com/gundem/korona-nin-dayandigi-temel-cokebilir-pcr-testi-kibris-ta-h137719.html

https://www.5gvirusnews.com/hukuk/pcr-dunyada-ilk-kez-kktcde-yargilanacak-h484.html

 

 

[/et_pb_text][/et_pb_column][/et_pb_row][/et_pb_section]

 

DSÖ’nün 17 Ocak 2020 tarihinde kabul ettiği PCR tanı kiti ile COVİD-19’u dünyaya yaydıktan sonra, 12 Mart 2020 tarihinde ilan ettiği pandeminin bütün şifreleri çözüldü. İşte çözülen bu şifrelerin başında, DSÖ’nün PCR test kiti protoklünü kabul ettiği Berlin Charite Viroloji Enstitüsü Prof. Direktörü Christian Drosten’in yazdığı makalede, Virüs İZOLATLARI ile ilgili elinde materyal olmadığını itiraf etmesi vardı. Dava da izole edilmemiş virus ile var edilen PCR tanı kitiyle test yapılmasına karşı açıldı.

Açılan davada COVİD-19 virüsünün İZOLATLARI, yani enfekte olmuş bir kişiden veya doğal ortamdan elde edilmiş, laboratuvar kökenli olmayan, mikrobiyal veya viral anlamda saf bir numune olmadığı halde, PCR tanı kiti ile pozitif sonuç tespit edilerek vaka sayısı oluşturulduğu belgelendi.

Dava metninde dünyanın her yerinde olduğu gibi KKTC’de ne işe yaradığı belli olmayan PCR test kiti ile insanların bedenine müdahale edildiği ve bunun da yasalarda yer olmadığı yer aldı.

Daha önce Portekiz de 11 Kasım 2020 tarihinde açılan bir davada mahkeme, PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin karar verdi. 23 Kasım 2020 tarihinde ise Berlin’de PCR tanı kitini DSÖ’ye kabul ettiren Christian Drosten’in sahte salgına neden olduğu için hakkında dava açıldı. Bunun üzerien DSÖ, 14 Aralık 2020 ve 20 Ocak 2021 tarihinde PCR testlerinin döngü sayısının fazla oluşu nedeni ile yanlış pozitif verdiğine ilişkin açıklama yaptı.

Dünya’da Seda OKGÜL’ün KKTC Yüksek İdare Mahkemesi’nde açtığı davada PCR tanı kiti ilk kez yargılanıyor..

 

 

DAVA METNİ

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.

                                                                                                                      YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

 

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

   Başsavcılığı, Lefkoşa.

                                                                                                           Arasında

Yukarıdaki Davacı Tarafından

TALEP TAKRİRİ

Malumunuz olsun ki, yukarıda adı yazılı davacı aşağıdaki çareler için Mahkemeye başvurur;

Şöyle ki;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının  hükümsüz ve/veya etkisiz ve/veya herhangi bir sonuç doğurmayacağına dair karar verilmesini;

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup , açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının bir ihmal olduğuna ve/veya böyle bir ihmalin yapılmaması gereken bir ihmal olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararının iptal edilmesi gereken bir karar olduğu hususunda bir emir.

Davalıların müştereken ve/veya münferiden ve/veya Davalı No.2 ve/veya No.3’ün görüş ve önerisi ile alınmış ve/veya Davalı No.2 ve/veya No.3 tarafından alınmış olan 27/02/2021 tarihli olup, açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar yoklukla  maluldur  ve/veya mutlak butlanla sakattır  dolayısı ile mezkur karar etkisiz,  hükümsüz ve/veya herhangi bir sonuç doğurmayacak bir karardır ve dolayısı ile iptal edilmesi gereken bir karar olduğu hususunda bir emir.

İşbu dava masraflarıdır.

İşbu dava KKTC Anayasasının 152. Maddesine, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere istinad eder.

Bu Dava Aşağıdaki Hukuki Esaslara Dayanır:

  1. Davalı dava konusu kararı değerlendirirken ve/veya dava konusu kararı alırken  ihmalde bulundu. Keza davacının haklarını ihlal etmekte ve/veya davacıyı mağdur etmektedir.
  1. Davalının, Dava konusu karar ve/veya işlemleri ve/veya eylemleri Anayasaya ilgili mevzuata ve/veya Doğal Aalet ilkelerine ve/veya Hak ve Nisfet Hukuku kaidelerine aykırı ve/veya gayrı yasaldır ve/veya hükümsüzür.
  1. Davalı 27/02/2021 tarihli kararı istihsal ederken ve/veya ve/veya değerlendirme yaparken ilgili mevzuatı yanlış anlamış ve/veya hatalı uygulamış ve/veya eksik uygulamışdır.
  1. Dava konusu karar ve/veya işlem ve/veya işlemler gerekçeden yoksundur ve/veya keyfidir ve/veya hatalı değerlendirmelere dayanmaktadır ve/veya yasal dayanağı yoktur ve/veya kanunilik ilkesine aykırı bir şekilde karar alınmıştır.  
  1. Davalı, Dava konusu kararı alıırken ve/veya işlemleri yaparken  yeterli inceleme ve/veya araştırma yapmadı  ve/veya eksik ve/veya  hatalı inceleme yaptı . Ayni nedenle bunlar neticesinde  hatalı kararlar istihsal etti ve/veya  işlemler yaptı .
  1. Dava konusu karar alınırken ve/veya işlemler yapılırken davalı yetkilerini aştı  ve/veya yetkisiz olarak karar aldı  ve/veya yetki aşımı ile kararlar aldı ve/veya bu kararlar doğrultusunda işlemler yaptı  ve/veya yetkilerini kötüye kullandı  ve  dava konusu kararları bu suretle istihsal etti.

Bu Davayı Desteklemek İçin Aşağıdaki Olgulara Dayanılır:

  1. Davacı Lefkoşa’da ikamet etmekte olup, takriben ve/veya 19 yıldır Avukatlık mesleği ile iştigal etmektedir.
  1. Davalı No.1, KKTC Bakanlar Kurulu olup, yönetsel faaliyetlerde bulunan ve/veya genel siyaseti belirlemekte ve/veya yasa gücünde kararname çıkarmakta ve/veya Anayasa’da belirtilmiş ve/veya sayılmış görevleri yerine getirmektedir. Davalı No.2 KKTC Sağlık Bakanlığı Anayasanın 45. Maddesi gereğince “herkesin beden ve ruh sağlığı içinde yaşayabilmesini ve tıbbi bakım görmesini sağlama ödevi olan yürütsel ve yönetsel yetki kullanan bir organ ve/veya  makam ve/veya Bakanlıktır ve/veya kamu tüzel kişiliğine haizdir. Davalı No.3 Davalı No.2’ye bağlı olarak faaliyet göstermekte ve/veya 45/2018 sayılı Bulaşıcı Hastalıklar Yasası kapsamında kurulan bir kurul ve/veya komitedir.
  1. Takriben ve/veya 2019 yılı sonlarında Çin’de başladığı iddia olunan ve daha sonra dünya genelinde 17 Ocak 2020 tarihinde DSÖ tararından kabul edilen PCR tanı kiti ile  Şubat 2020 yılı itibarı ile dünya genelinde görülmeye başlamış ve Covid-19 olarak isimlendirilmiş ve/veya 12/03/2020  tarihinde de Dünya Sağlık Örgütü tarafından pandemi ilan edilmiştir. Bunun üzerine tüm devletler toplum sağlığı iddiası ile önlem almışlar ve/veya zaman zaman da bu önlem ve/veya tedbirlerini değiştirmek ve/veya sürece uydurmak adına da farklı önlemler almışlar ve/veya Anayasa’da yer alan kişi hak ve özgürlüklerini kısıtlamak sureti ile de önlem ve/veya tedbirlerini değiştirmişlerdir.  
  1. Bu süre içerisinde ve/veya dünya genelinde Covid-19 olarak isimlendirilen virüs sonucu DSÖ tarafından ilan edilen pandemi, PCR testi için boğaz ve burundan sürüntü örneği alınarak tespit edilmeye çalışılmıştır.
  1. Davacı iddia ve beyan eder ki; süreç içerisinde yapılan çalışmalar ve/veya tıbbi çalışmalar ve/veya gözlemler neticesinde PCR olarak adlandırılan test kitlerinin kullanılması doğru değildir ve/veya hatalıdır. Davalıların bu konudaki kararlarının ayrıca yasal hiçbir zemini de yoktur. Şöyle ki;
  1. YASAL OLARAK:
  1. a) Davacı iddia ve beyan eder ki, PCR test kitleri ile Covid-19 virüsünün tespit edileceğine ve/veya edilmesi gerektiğine dair yasal herhangi bir zorunluluk yoktur ve/veya PCR testinin uygulanacağına ve/veya uygulanmasının zorunlu olacağına dair icbar mümkün değildir ve yasada da düzenlenmiş değildir. Her halukarda 45/2018 sayılı yasaya göre bir kimsenin muayene edilebilmesi için Mahkeme emri dahi aranmaktadır.

Her halukarda Virüsler kan testleri ve sair testlerle ve/veya antijen testleri ile de tespit edilebilecekleri gibi PCR, sürüntü testlerinin yasal olarak yer almaması nedeni ile kullanılmaya mecbur bırakılmasına dair alınmış karar ve/veya kararlar ve bu kararlar nedeni ile yapılan işlemler hatalıdırlar.

b)Davacı iddia ve beyan eder ki, 45/2018 sayılı yasa muayene edilmek hususunda zorunluluk getirmemektedir. Dolayısı ile PCR testleri ile sağlıklı olup olunmadığına dair muayene işlemi zorlanamaz ve/veya zorunlu olarak PCR testleri yapmak hususunda icbar edinilemez. Dolayısı ile Davalıların müştereken ve/veya münferiden PCR testleri ile hastalığın ve/veya Covid-19 virüsünün tespit edilmesi için muayene maksatlı PCR testi yapılmasına dair almış oldukları kararlar hatalıdır.

  1. BİLİMSEL VE/VEYA TIBBİ OLARAK:

a)PCR Testlerinin amacı Virüs Tespit etmek değilidir.

Davacı iddia eder ki, PCR sürüntü testleri genetik hastalıklar ve/veya prenetal tanı, adli tıp, kanser araştırmaları, babalık testleri, DNA analizi gibi analizlerin yapılması için yapılmıştır.

b)Yanlış pozitif çıkarabilir.

PCR Testleri spesifik ve güvenli testler değidir. PCR Testlerinin döngü sayısı DSÖ tarafından 14 Aralık 2020 ve  20 Ocak 2021 tarihinde de Başkan Tedors Adhanom Ghebreyesus’un daha önce kabul edilen  45 döngünün fazla pozitif  bulduğundan aşağı çekilmesi istenmiştir.

Yine alınan numunede başka virüs RNA/DNA’sının olması halinde (Influenza virüsü gibi), bunların döngüye girip kopyalanma ihtimali ve boyamada yanlış pozitif çıkma ihtimali vardır.

c)Davacı iddia eder ki, SARS-CoV2 virüsü izole edilmemiş olduğundan ve DSÖ’nün kabul ettiği (17 Ocak 2020) protokolde bu durum açıkça yazılmış olmasına rağmen test sonuçlarının doğruluk oranını saptamak için kullanılabilecek bir altın standart yoktur, olamazda. O nedenle bu testlerde elde edilecek sonuçlar tümüyle geçersizdir.

Ahar surette;

d)Virüs izolasyonu olduğu kabul edilse bile kullanımda mevcut sürüntü testlerinin hiçbirinin resmi verifikasyon ve validasyonu yoktur ve/veya ruhsatsızdır.

e)Cihazların %99’unda hangi gen diziliminin olduğu bilinmemektedir ve/veya sürüntü testlerinin birçoğunda, taşıdıkları gen dizilimleri (sekansları) deklare edilmiş ve/veya açıklanmış değil.

f)PCR testinin tekrar sayısına göre ölü virüsün geninin de çoğaltılarak, virüs aktifmiş gibi PCR pozitif sonucunu verebilir ancak bu aktif bir enfeksiyonun kanıtı değildir.

g)PCR testleri döngü sayısı göre %63-65 arası pozitif  yakalamaktadır. Sırf bu nedenle dahi güvenilir değildir.

h)PCR testleri sonuçlarını bilimsel olarak zayıf pozitif şeklinde vermez. Oysa bu mümkündür ancak PCR testi buna fırsat tanımaz ve PCR pozitif gösterir.

ı)E, N ve RdRp2 geninin herhangi birinin varlığı halinde yeterli pozitiflik kabul edildiğinden pozitif sayısı fazla görünmektedir. Oysa bu Nisan 2020 tarihine kadar her üç genin de aranması yönünde idi.

i)Virüsün mutasyona uğruyorsa, önceden hazırlanan test kitleri ile bugün mevcut virüsü aramak mantık dışıdır. Yine virüs her ülke ve coğrafyaya göre değişiklik gösterdiği iddia edildiğinden bu test kitleri geçersiz sayılmalıdır.

j)Gen dizilimi için model olarak kullanılan patojenik sıvılarda ne bir virüs titrasyonu ne de kuantifikasyonu yapılmış olduğundan, buradan, o sıvılar dahilinde milyarlarca virüs benzeri partikülün (insan organizmasında doğal olarak bulunan ve patojenik özellik taşımayan ekstraselüler veziküller dahil) bulunduğu anlaşılabilir.

k)Esas itibariyle, farinjiyal veya nazal COVID-19 sürüntü testlerinin hiçbir diyagnostik   değeri bulunmamaktadır.

l)PCR testleri burun içerisine nazofarenks denilen bölgeye kadar inmekte ve sürüntü bu bölgeden alınmaktadır. PCR testleri üzerinde mevcut herhangi bir bakteri bu bölgeye sürüntü testi ile aktarıldığı taktirde kişinin hastalanmasına yol açmaktadır. Dolayısı ile işlemin yapılışı açısından da hatalı ve/veya risklidir.

            C)BİREYSEL OLARAK:

Davacı iddia eder ki, PCR testlerinin üretilmesinin temel amacı virüs tespiti değil, DNA analizidir. Her halukarda PCR testlerinin nasıl imha edildiği belli olmamakla birlikte bir toplumun da DNA örnekleri alınmaktadır. Dolayısı ile aynı zamanda etik de değildir ve/veya kimsenin DNA’sı zorlanmak sureti ile ve/veya alınacak kararlarla ve/veya rızası dışında da temin edilmemelidir. Nitekim Davalıların müştereken ve/veya münferiden almış olduğu kararlar Davacının DNA’sının da alınması neticesini doğuracaktır ki, Davacının buna rızası yoktur.

  1. Davacı iddia ve beyan eder ki, Davalıların müştereken ve/veya münferiden almış oldukları kararlar nedeni ile ve/veya 15 günde bir yenilenmek kaydı ile PCR testi yaptırtmak ile ilgili kararları neticesinde Davacının çalışma hakkı da etkilenmektedir. Davacı PCR testi olmaksızın çalışamama ihtimali ve dolayısı ile kendisini ekonomik olarak geliştirememe ihtimali taşımaktadır ki yasal dayanağı olmayan bir test ile Davacının Anayasal hakları etkilenecektir. Yine bu test ile hatalı pozitif olma ihtimali söz konusu olabilir. Bir kimsenin pozitif çıkması ile kişi Anayasaya aykırı bir şekilde kişi özgürlüğünden yoksun bırakılarak Karantina otellerine yerleştirilmekte ve kendisine derhal tıbbi tedavi uygulanmaya başlanmaktadır. Her halukarda uygulanan tedavinin tedavi protokolü dahi bulunmamaktadır ve/veya Davalı No.2 ve/veya No.3’ün uyguladığı tedavi PCR pozitif olup, gerek hatalı, gerekse gerçek pozitif olan kimselerde ciddi sağlık sorunlarına yol açmaktadır ve/veya Davalı No.2 ve/veya No.3 ve/veya Davalılar müştereken ve/veya münferdien PCR pozitif kimselere hatalı ve/veya yanlış ve/veya gereksiz tedavi de uygulayabilmektedirler. Dolayısı ile muhtemel bir hatalı pozitif, yukarıdaki iddialara halel gelmeksizin bir kişinin temel hak ve özgürlüklerini sınırlayacağı gibi ve/veya kişi özgürlüğünü sınırlayacağı gibi, ülke içerisinde gereksiz önlemlerin alınmasına sebebiyet vermek sureti ile Anayasa’da yer alan birçok kişi hak ve özgürlüklerinden men edilmesini sağlayacak tedbirler alınması sağlanacak ve/veya kişilerin ve/veya spesifik olarak Davacının Çalışma Hakkı, Hayat ve vücut bütünlüğü hakkı, sağlıklı yaşama hakkı ve/veya sağlık hakkı gibi hakları da etkilenecektir.

7.Davacı iddia ve beyan eder ki, Davalının yapmış olduğu işlemlerin ve/veya almış oldukları kararlarda ve bu konuda verilmiş olan karar ve/veya yapılmış olan işlem ve/veya eylem ve/veya ihmal tamamen hatalıdır ve/veya yanlıştır. Bu karar ve/veya kararlar Davacıyı zarar ve ziyanlara düçar bırakmakta ve mağdur etmektedir ve dolayısı ile işbu kararın iptal edilmesi gerekmektedir.

8.İşbu YİM konusu karar ve/veya işlemler nedeni ile Davacının işbu YİM davasını dosyalama mecburiyeti hasıl olmuştur ve/veya işbu kararların alınması ve/veya bu hususta yapılan işlemlerin ve/veya 27/02/2019 tarihli karar nedeni ile Davacının münferiden meşru menfaatleri etkilenmektedir ve işbu davayı dosyalamakta da meşru menfaati bulunmaktadır.

İşbu dava Davacı Avukatı Boysan Boyra tarafından tanzim edilmiştir.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa’dır.

                                                              Boysan Boyra

                                                      Davacı Tarafından Avukat

………/….03…../2021 tarihinde

kaydolunup mühürlenmiştir.

                                      Mukayyit.

Not: Bu davaya verilecek bir müdafaanın davanın tebliğ tarihinden itibaren yirmi bir (21) gün zarfında kayıt kalemine bizzat veya Avukat vasıtasıyle verilir ve bir sureti davacıların tebliğ adresine bırakılır.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

  1. Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle, KKTC

                Başsavcılığı  Lefkoşa, KKTC.

                                                                                                          ARASINDA.

                                                                                  

Yukarıdaki Müstedi tarafından yapılmış tek taraflı istida:

Yukarıdaki Müstedi işbu istidası ile;

  1. Esas başvurunun nihai bir karara bağlanmasına ve/veya Muhterem Mahkeme’ce takdir ve tayin edilecek bir tarihe kadar; Davalılar tarafından müştereken ve/veya münferiden takriben ve/veya 27/02/2021 tarihinde alınan ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair kararın icraasını men edici bir emir ve/veya geçici bir ara emri verilmesi ve/veya yürütmenin durdurulmasına dair bir emir verilmesi zımnında bir Mahkeme emri itası;
  1. Muhterem mahkemece uygun görülecek başka bir emir ve/veya çare.
  1. Bu istida masraflarının M/aleyhlere tahmili.

 için gerekli emrin isdarını talep eder.

İşbu başvuru KKTC. Anayasa’sının 152, Anayasa’nın 10. Temel Hakların Niteliği ve Korunmasına Dair maddesine, 14. Kişi Dokunulmazlığı ile ilgili maddesine, 15. Hayat ve Vücut Bütünlüğü Hakkı ile ilgili maddesine, 16. Kişi Özgürlüğü ve Güvenliği ile ilgili maddesine, 45. Sağlık Hakkı ile ilgili maddesi ile sair ilgili maddelerine ve Avrupa İnsan Hakları Sözleşmesi’nin İnsan Haklarına Saygı yükümlülüğü ile ilgili 1. Maddesine, Yaşam Hakkı ile ilgili 2. Maddesine ve sair ilgili maddelerine, diğer ilgili mevzuat ile Doğal Adalet, Hak ve Nisfet Hukuku kaidelerine ve konu ile alakalı içtihadi prensiplere ve Yüksek Mahkeme Tüzüğüne istinad eder.

Bu istidada istinad edilen gerçekler Lefkoşa   sakinlerinden Seda Okgül’ün  ilişikte sunulan  yemin varakasında gösterilmektedir.

 

Bu istida Müstedinin Avukatı Boysan Boyra tarafından yapılmıştır.

Tebliğ Adresi: Mahmut Paşa Kapalı Otoparkı altı, Lefkoşa’dır.

                                                                                                          Boysan Boyra

                                                                                              Müstedi Tarafından Avukat.

2021  senesinin Mart  ayının   2. günü

dosyalanmıştır. Dinlenmesi için  2021 senesi

Mart ayının …………..gününe tayin edilmiştir.                 

                                                                                                                                                                    Mukayyit.

YÜKSEK İDARE MAHKEMESİNDE

ANAYASANIN 152. MADDESİ HAKKINDA.                          YİM:………../2021

Davacı:Seda Okgül, Mahmut Paşa Kapalı Otoparkı Altı, Lefkoşa.

                                               -ile-

Davalı:1.KKTC Bakanlar Kurulu, KKTC Başsavcılığı vasıtasıyle, Lefkoşa.

2.KKTC Sağlık Bakanlığı, KKTC Başsavcılığı vasıtasıyle, Lefkoşa. KKTC.

3.Bulaşıcı Hastalıklar Üst Komitesi, KKTC Sağlık Bakanlığı vasıtasıyle                   Başsavcılık  Lefkoşa.

                                                                                                          ARASINDA.

                                                                           

 

                                                        YEMİN BELGESİ

Ben aşağıda imza sahibi Lefkoşa  sakinlerinden Seda Okgül , yemin eder ve bu yeminimle aşağıda gösterilen hususları beyan ederim.

  1. Yukarıda unvan ve sayısı gösterilen başvuruda davacı ve işbu istidada ise  Müstediyim.
  1. Bu istida maksatları bakımından esas başvurumdaki tüm iddiaları burada aynen tekrarlar ve benimserim.
  1. DSÖ tarafından ilan edilen pandemi nedeni ile Covid-19 virüsünün tespiti bir nevi PCR testlerine bağlanmıştır. Oysa ki PCR testleri dışında başka alternatif testler vardır. Mesela kan testleri ve sair testler uygulanarak virüsler tespit edilebilir. Davamda da açık olarak belirtmiş olduğum gibi, PCR testleri ciddi hatalar vermektedir. Her halukarda özetle;

Bu testlerin yasal dayanağı yoktur. Herhangi bir kimsenin bir başka kimseyi Bulaşıcı Hastalıklar yasası Tahtında muayene edebilmesi için Mahkeme emrine ihtiyaç duyması gerekmekte iken, Davalı/M/aleyhler yasa dışı bir şekilde ve/veya Almış oldukları ve yayınladıkları kararlar ile zorunlu olarak PCR testi yaptırtmak surety ile muayeneye tabi tutmaya çalışmaktadırlar. Ancak az önce bahsettiğim üzere bunu yapabilmek ilgili yasada Mahkeme ermine bağlanmışken, Davalılar yetki aşımı yapmak suretiyle ve icbar ederek, PCR testi vasıtası ile Covid-19 virüsünü tespit etmeye çalışmaktadırlar. Her halukarda mezkur muayeneyi hasta oluğundan şüphelenilen kişiler yerine sağlıklı kişiler üzerinde yapmaktadırlar ki, bu test ve alınan kararlar amacı aşmaktadır.

Yine mezkur testler birçok sebeple hatalı sonuç vermektedirler. Herhangi bir virüsün varlığı ve/veya ölü bir virus varlığı dahi, PCR testlerinin döngüsünde çoğaltılmakta ve aşırı çoğaltmada (-ki döngü sayısı değiştirilmiş olmasına rağmen) Davalılar PCR testlerinin ve/veya ilk nazarda DSÖ nün Kabul edip daha sonra değiştirdiği döngü sayısını uygulamakta ısrar etmekte ve hatalı pozitifler yaratmaktadırlar.

Bir diğer önemli husus ise mezkur testler sürüntü testleri olup, bu testler burun ve akabinde boğaza sürüntü yapılarak yani, tükürük de alınarak yapılmaktadır. İddia ederim ki, PCR testleri DNA analizleri yapmak için kullanılan test türleridir. Davalılar müştereken ve/veya münferiden kararlar almak suretiyle şahsıma ait DNA analizlerini çıkarabileceklerdir. Ancak böyle bir hususa rızam yoktur. Böyle birşey bedenime ait olan anahtarın tümü ile Davalıların eline geçmesine neden olacağından, bedenimin tüm zayıflıklarını tespit edebilme ihtimaline de yol açacaktır. Kaldı ki, mezkur testlerin imha edilip edilmediği, ve/veya nasıl ve ne şekilde imha edildiği belli değildir, hiç açıklanmamıştır. Şahsen bu husus beni ayrıca rahatsız etmektedir.  Kendi bedenim ve sağlığım üzerinde söz hakkım bulunmakta olduğuna inanmaktayım.

  1. İddia ve beyan ederim ki, Davalıların bu kararı aynı zamanda Anayasa ile korunma altına alınan kişi hak ve özgürlüklerin özüne dokunmaktadır.
  1. Her halukarda Davalıların baz aldığı bu PCR testleri ifade etmiş olduğum gibi hatalı pozitif vermekte ve/veya bir kimse önce pozitif, sonra negatif veya döngüye göre pozitif vermektedir. Herhangi bir şekilde hatalı pozitif temin edilmesi halinde,  Anayasaya aykırı olduğunu düşündüğüm karantina otellerine kapatılarak tedavi edilmem sonucunu dahi doğurabilecektir ki, Davalı No.2’nin uyguladığı sağlık protokolleri belirsizdir ve/veya yanlış uygulamalar olduğu duyumlarını almaktayım .
  1. Yukarda yer alan tüm nedenlerle  ve açık olan sektörlerde çalışan kişilerin her on beş günde bir PCR testlerini yineleyeceklerine dair karar inancım odur ki, yoklukla malul bir karardır ve/veya hatalıdır ve bu nedenle de hükümsüz ve/veya etki doğurmaması gereken bir karardır ve işbu nedenle de iptal edilmesi gerekmektedir.
  1. İddia ve beyan ederim ki, Davalıların almış olduğu karar ve/veya işbu karar doğrultusunda yapılan işlemler, açıkça kanuna aykırıdır. Hatta kanuni değildir ve yasal dayanağı yoktur.
  1. Yine,  iddia ve beyan ederim ki, karara bağlanması gereken kony ciddidir ve iddialarımda haklı olduğuma dair belirtiler mevcuttur, keza ara emri verilmez ise ileride telafisi mümkün olmayacak bir zararın doğması mümkündür. Mesela mezkur karar çalışma hakkımı engellemekte, hatalı bir netice de ortaya koyabileceği ve tedavi görmeme neden olabileceği gibi, DNA mın temin edilmesine de neden olacaktır. Kaldı ki, alınan kararlar gereği PCR testi yaptırmış değilim ve yaptırmak konusunda da rızam yoktur ve/veya yaptırmak zorunda olmadığıma da inanmaktayım. 
  1. Yukarıdakiler gereğince karara bağlanması gereken konunun çok ciddi ve acil olduğu inancındayım ve davanın adilane bir şekilde kararlaştırılabilmesi için böyle bir emrin verilmesine ihtiyaç olduğuna inanmaktayım.
  1. Tüm yukarıda iddia etmiş olduğum sebeplerle bu  istida ile talep edilen emrin verilmemesi halinde ileride telafisi imkansız zarar ziyana uğramam söz konusu olacak, geriye dönüş imkansızlaşacaktır ve/veya çok zorlaşacağına inanmaktayım.
  2. Yukarıda gerçekler ışığında istida da olduğu gibi emir verilmesinin adil ve hakkaniyete uygun olduğu inancı ile bu doğrultuda talepte bulunurum.

                                                                      Yemin eden

                                                           ……………………………………

Seda Okgül  

2021Yılı Mart ayının 2..günü

yemin ve imza edilmiştir.                   Mukayyit.         

 

 

https://www.habervakti.com/gundem/korona-nin-dayandigi-temel-cokebilir-pcr-testi-kibris-ta-h137719.html

https://www.5gvirusnews.com/hukuk/pcr-dunyada-ilk-kez-kktcde-yargilanacak-h484.html

 

 

[/et_pb_text][/et_pb_column][/et_pb_row][/et_pb_section]
Pandemi Yok, Covid Aşıları Gereksiz ve Tehlikeli

Pandemi Yok, Covid Aşıları Gereksiz ve Tehlikeli

İşin uzmanından görüş almak ister misiniz?

Burada konuşan doktorların büyük çoğunluğu ya işinden oldu ya karalandı ya emekliliğini almaya zorlandı ve istisnasız hepsi sansürlendi.

Tek soru: Neden?

Kritik eşikteyiz.

Bunlar Da İlginizi Çekebilir

Somatoscope

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını...

Son haberler

‘Gerçek Bilim’ vs. ‘Kâbus Film’ – 1. Bölüm

İki tıp sisteminin karşılaştırmasını sunuyoruz; biri Pastör’ün mikrop teorisine [monomorfizm/tek biçimci ekol] dayanıyor, diğeri Béchamp’ın hücre teorisine [pleomorfizim/çokbiçimci ekol].Mikrop teorisine göre dışarıda hazır bekleyen mikroplar var ve bunlar insan...

Sokağa Çıkma İhlali Cezasına İtiraz

Aşağıdaki dilekçe örneğini bilgisayarınıza indirip gerekli yerleri doldurarak, sokağa çıkma cezasına itiraz edebilirsiniz. Dilekçenin devamında, anayasal kanıtları içeren, hukuka uygunsuzluk sebepleri net bir şekilde açıklanmış bir makale mevcuttur. Aynı zamanda tüm...

Virolojinin Gözler Önündeki Büyük Sırrı – İzolasyon Yalanı

Sahte tanı kitleri, pandemiye özel hukuki altyapısı ve simülasyonlu tatbikatı seneler öncesinden hazır edilmiş Covid-19 adı verilen sahne şovunun grafik tasarım ürünü, "Mr. Spikey" Sars-CoV-2 virüsünü tek başına ortaya koyup gösterene verilecek para ödülü 1 milyon...

Corona Sürecindeki Hikayelerine Talibiz

Bizimle konu hakkındaki her türlü duygu, düşünce ve yorumunu paylaşarak bu platforma sen de katkı sağlayabilirsin.

Bize Katıl

Yabancı dilden Türkçe’ye çeviri konusunda destek olmak ya da kendi alanın çerçevesinde paylaşımlarımıza katkı sağlamak istersen, bize yazabilirsin.

Bizi takip et

Güncel paylaşımlardan haberdar olmak ister misin?

Sağlık Bakanlığı’na Sorduk: SARS-CoV-2 İzolatınız Nerede?

Sağlık Bakanlığı’na Sorduk: SARS-CoV-2 İzolatınız Nerede?

1 Aralık 2020 itibariyle dünya genelinde 39 resmi kurum ve kuruluşa, CV-19 hastalığına yol açtığı iddia edilen ve SARS-CoV-2 ismiyle atıfta bulunulan virüsün, iddia edildiği üzere bu virüs dolayısıyla hasta düşmüş birinden alınıp laboratuvar ortamında izolasyon/saflaştırma prosedürlerinin gerçekleştirilmiş olduğunu gösteren bir yayın, herhangi bir resmi kayıt veya rapor sunmaları için yapılan başvuru sonuçsuz kaldı diyor bu site ve Bilgi Edinme Hakkı kanunu çerçevesinde yapılmış tüm başvurular ve bunlara verilen resmi cevapları şurada yayınlıyor.  

Biz de bunlara, Türkiye Cumhuriyeti Sağlık Bakanlığı’nın yanıtsız bıraktığı 40. sorguyu ekliyoruz.

Diğer tüm ülkelerde kurumlardan ellerinde istenilen nitelikte bir belge olmadığı yönünde bir yanıt gelirken, T.C. Sağlık Bakanlığı’na bağlı kurum, yapılmış resmi sorguya yine bir soruyla karşılık vermeyi tercih ederek, açıkça istenilen bilgiyi vermekten kaçınıyor. 

13.10 2020 Tarihli Sorgu:

Sorgunun Açık Metni:

Talep Edilen Belgeler:

TC Sağlık Bakanlığı Halk Sağlığı Genel Müdürlüğü Mikrobiyoloji Referans Laboratuvarları ve Biyolojik Ürünler Dairesi Başkanlığı da dahil olmak üzere, Sağlık Bakanlığı’nın bilgisi ve yetki alanı dahilindeki tüm birimler için geçerli olmak üzere, hastadan alınan numuneye genetik materyal karışmasına neden olabilecek başka hiçbir hiçbir kaynak (vero hücreleri olarak adlandırılan maymun böbreği hücreleri, insan karaciğer veya akciğer kanser hücreleri gibi) kullanılmaksızın, doğrudan hastadan temin edilmiş numuneden izolasyonu gerçekleştirilmiş  SARS-CoV-2 virüsüne dair tüm dokümantasyon. 

Önemli: Burada “izolasyon” kelimesinden kasıt, virüsün başka her şeyden ayrılarak, tek başına gösterilmiş olmasıdır. “SARS-CoV-2 izolasyonu” dendiğinde kastedilen, bir şeyin kültürlenmesi yahut bir amplifikasyon testi (örn. PCR cihazı) marifetiyle ölçüm alma veyahut da bir şeyin gen diziliminin ortaya çıkarılmış/yapılmış olması, değildir.

Sağlanacak belgelere doğrudan erişim sağlayabileceğimiz şekilde, eğer ortada yapılmış bir yayın varsa yayının başlığı, yazar isimleri, yayımlanma tarihini, yayımlanmış olduğu tıp dergisinin ismi gibi bilgilerin açıkça belirtilmiş olmasını rica ediyoruz.

14.11.2020 tarihinde, Mikrobiyoloji Referans Laboratuvarları ve Biyolojik Ürünler Dairesi Başkanlığı tarafından verilen yanıt: 

Cevabı ver(emeye)n kurum, daha Ocak ayında, tıpkı ünlü Alman virolog Prof. Christian Drosten gibi, daha ortadaki salgının koronavirüs kaynaklı olup olmadığı dahi teyit edilmemiş ve Çin’de virüs izolasyonu gerçekleştirilmemişken bu “yeni” virüse ait genleri aratarak çalışacak bir tetkik kiti oluşturduklarını iddia ve ilan ederek, normal şartlarda skandal sayılması gereken ve şu anda da Alman viroloğun tam da bu nedenlerden dolayı dava edilmekte olduğu çıkışı gerçekleştirmiş Türkiye Cumhuriyeti Sağlık Bakanlığı Halk Sağlığı Genel Müdürlüğü Mikrobiyoloji Referans Laboratuvarları ve Biyolojik Ürünler Dairesi Başkanlığı ve bu dairenin o zamanki başkanı Prof. Dr. Selçuk Kılıç.

2020 başından sonuna kadar Sars-CoV-2 virüsü iddiasıyla ortaya çıkan küresel irtikap şebekesinin icraatlerine yakından bakalım.

ÇİN, ALMANYA VE TÜRKİYE EKSENİNDE OLAYLARIN GELİŞİM SIRALAMASI

30 Aralık 2019: Çinli göz doktoru Li Wenliang, WhatsApp uygulaması üzerinden doktor arkadaşlarına hastanesinde SARS pozitif 7 hasta olduğunu iletir. 

31 Aralık 2019: Başkent Pekin, Wuhan’a incelemelerde bulunmak üzere bir grup virolog gönderir.

1 Ocak 2020: Berlin Tıp Fakültesi’ne bağlı Charité Viroloji Enstitüsü başkanı ve devlet baş danışmanı Prof. Christian Drosten bu haberi alır almaz SARS virüslerinin tetkiki için diagnostik cihaz geliştirmeye girişir, halbuki henüz Çin’den gelen bildirimin ne doğruluğu resmi kaynaklarca teyit edilmiştir ne de olay yerine gönderilen virolog ekip bulgularını yayımlayabilmiştir. Yayımlanmış çalışmalarında geçen şu ifadeler hayli ilgi çekici olacaktır:

Çalışmanın Amacı: “Elimizde virüs materyali olmadan, halk sağlığı laboratuvar ortamlarında kullanıma yönelik güçlü tanı metodolojisi geliştirip üretmeyi amaçlamaktayız.”

Ve

“Bu defaki 2019-nCoV’da ise, virüs izolatı veya enfekte hastalardan alınmış numuneler henüz uluslarası halk sağlığı camiasının eline geçmemiştir. Burada, 2019-nCoV taraması ve spesifik konfirmasyonu için virüs izolatı yahut hastalardan alınmış orijinal numuneler olmadan tasarımını gerçekleştirmiş olduğumuz tanı prosedürünün kurulum ve validasyonunu bildirmekteyiz. Tasarım ve validasyon 2003 SARS-CoV ile yakın genetik akrabalık sayesinde mümkün olabilmiş ve sentetik nükleik asit teknolojisi de gelişimine yardım etmiştir.”

Drosten bunun dışında, yayındaki bildiriminden anlaşıldığı kadarıyla, Çin’de sosyal medyada SARS benzeri bir tabloya yol açan bir virüs bulunduğu yönündeki bildirimlere itibar ederek, bu olsa olsa SARS ile ilintili bir koronavirüstür şeklinde fazlasıyla isabetli bir tahmin yürütüyor ve bu varsayımla, 1 Ocak 2020 itibariyle, ne olduğu hiçbir şekilde konfirme olmayan bu yeni virüse tanı kiti geliştirebilirim diye gen bankasından eski SARS ile alakalı gen sekanslarının tümünü indiriyor. 

WHO’nun Yeni Oluşumlu 2019-nCov için 1 no’lu Durum Raporu’nda verilen bilgiye göre, Çinli yetkililer 7 Ocak 2020 tarihinde izolasyonu gerçekleştirilmiş yeni tip bir koronavirüs bulunduğunu açıklıyor ve 12 Ocak 2020’de de Çin, virüse özel tanı kitleri geliştirilebilsin diye  bu yeni koronavirüsün genetik sekansını (gen dizilimini) dünya kamuoyu ile paylaşıyor.  

WHO’nun bu bildirimindeki iddia şu: SARS-CoV-2 diye bir virüs izole edilmiştir (yani üzerinde çalışma yürütülmek üzere saflaştırılmıştır) ve bu şekilde tek başına ortaya konduktan sonra da içindeki genetik bilgi alınarak tek tek genlerin sıralanışı ortaya konmuştur.    

Halbuki ortada bir(kaç) sorun var.

Birincisi, Wuhan virüsüdür denilerek komple gen dizilimi çıkarıldığı iddia edilen sekansların daha sonra birçok defa güncellendiğini görüyoruz. Kaynak dizilimdeki bu güncellemelerin, (daha ortada komple gen dizilimi dahi yokken hazırlanmaya başlanmış) PCR’ların güvenilirliği açısından manası nedir, bilim kurulumuza değerlendirmeleri için soru olarak yöneltiyoruz.

İkincisi, SARS-CoV-2 için virüs izolasyonu tarif eden bilimsel yayınların yazarlarına tek tek ulaşılıp, laboratuvarda elde ettikleri yapıların elektron mikroskobu ile aldıkları görüntülerinde acaba saf halde virüs yapıları mı görülmekte olduğu sorulduğunda hiçbiri “evet” diyemiyor. 

İzolasyon adı altında yayımlanmış çalışmalarda, fotoğrafladıkları yapının bir virüse ait olduğunu kesin biçimde ispat edecek tek işlem olan ”saflaştırma”nın yapılmamış olması ve elbette yayımlanmış bütün bu deneylerin hiçbirinin kontrol düzeneği bulunmaması, bilimsel aldatmaca gibi vahim bir sonuca kapıyı ardına kadar aralamış oluyor. 

İşte çalışma yazarlarının, virüs izolasyonuna vermiş oldukları yanıtların bir özeti:

  1. Yayın: Leo L. M. Poon; Malik Peiris. “İnsan sağlığını tehdit eden yeni bir insan koronavirüsü ortaya çıkmış bulunuyor” Nature Medicine, Mart 2020

Çalışma kadrosundan soruya yanıt veren kişi: Malik Peiris

Tarih: 12 Mayıs 2020

Yanıt: “Şekilde virüs enfekte hücreden çıkarken görülmektedir. Saflaştırılmış hali değildir.”

İngilizcesi: “The image is the virus budding from an infected cell. It is not purified virus.”

  1. Yayın: Myung-Guk Han ve ark. “Kore’de COVID-19’lu hastadan izole edilmiş koronavirüsün tanımlanması”, Osong Public Health and Research Perspectives, Şubat 2020

Yanıt veren kişi: Myung-Guk Han

Tarih: 6 Mayıs 2020

Yanıt: “Saflaştırmanın derecesini kestiremiyoruz çünkü hücrelerde kültürlenmiş virüsü saf hale getirip konsantre ederek çalışmıyoruz.”

İngilizcesi: “We could not estimate the degree of purification because we do not purify and concentrate the virus cultured in cells.”

  1. Yayın: Wan Beom Park ve ark. “Kore’deki SARS-CoV-2’li ilk hastadan virüs izolasyonu”, Journal of Korean Medical Science, Şubat 24, 2020

Yanıt veren kişi: Wan Beom Park

Tarih: 19 Mart 2020

Yanıt: “Saflaştırma derecesini gösterecek şekilde elektron mikrografisi almadık.”

İngilizcesi: “We did not obtain an electron micrograph showing the degree of purification.”

  1. Yayın: Na Zhu ve ark., “2019’da Çin’deki Pnömonili Hastalarda Tespit Edilen Yeni Tip Koronavirüs”, 2019, New England Journal of Medicine, Şubat 20, 2020

Yanıt Veren: Wenjie Tan

Tarih: 18 Mart 2020

Yanıt: “Yayında çökelti halindeki virüs partiküllerini gösterdik, saflaştırılmış hallerini değil.”

İngilizcesi: “[We show] an image of sedimented virus particles, not purified ones.”

Wuhanlı bilimadamlarının, yayınlarında keşfetmiş oldukları yeni virionlar olarak (üstünde “spike” adı verilen çıkıntılar bulunan ve “virüs” RNA’sı taşıyan protein topçukları) lanse ettikleri elektronmikrografi görüntüleri ise yine kanıt teşkil etmiyor, zira vücudumuzda endositik veziküller ve eksozomlar başta olmak üzere bunlarla tıpatıp aynı görüntüde başka birsürü vezikül taşımaktayız.

 

 

 

(Solda) Sars-CoV-2’ye aittir denilen virion, (Ortada) Ekstraselüler Vezikül, (Sağda) Eksozom

Buradaki üçüncü sorun ise, virüs izolasyonu olmadan ve altın standart belirlenmeden tanıya yönelik hiçbir testin geliştirilemeyecek olması.  

Fakat bunlar, “tecrübeli” virolog Drosten için engel teşkil etmiyor ve Çin’den kendisine virüs izolatı iletilmemiş ve virüs henüz Avrupa’ya dahi ulaşmamışken, sosyal medya duyumları üzerine yöneldiği koronavirüs hedefi de daha sonra “doğrulanmış”ken, gen bankalarından seçip düzenlediği kes-yapıştır gen dizilimi bölümleri ile bize yeni virüsü saptayacak PCR protokolünü oluşturuveriyor.

Prof. Christian Drosten, 2003’te ortaya çıktığı iddia edilen SARS ile ilintili koronavirüsü de ilk keşfedenlerden biri olarak viroloji dalına ismini yazdırıyor. Ancak 2003 tarihli yayınında, o zamanki SARS virüsü bulgularının da yine aynı şekilde gerçek manada saflaştırma yapılmadan ve kontrol düzeneği olmadan yayımlanmış olduğu çeşitli kritiklerce belirtilmiş durumda. Kendisi 2009 yılındaki domuz gribi yanlış alarmında da devlet danışmanı olarak Pandemrix aşısının derhal uygulanmaya başlanması gerektiği ve aşı için tüm kuralların rafa kaldırılması lazım geldiğini ifade ederek devletin milyonlarca avroluk zarara uğramasından ve daha sonra bu aşının yol açtığı narkolepsi vakalarının ortaya çıkması ile çok sayıda kişinin ömür boyu sürecek feci bir hastalığın pençesine düşmesinden sorumlu bilimadamıdır. Prof. Drosten’ın üniversitesi Berliner Charité, en son 2020 Mart ayında Biil & Melinda Gates Vakfı’ndan 249.550 dolarlık hibe almıştır.

 

 

 

KAYNAK

 

 

 

Almanya’nın CDC’si olarak görev yapan Robert Koch Enstitüsü’nün 2019 Kasım ayında “çiçek aşısının ortaya çıkış ve geçirmiş olduğu evolüsyonu” araştırmak üzere B&M Gates Vakfı’ndan almış olduğu 253,000 dolarlık bağış bildirimi
KAYNAK

Tarih 21 Ocak 2020. Çin CDC’sinin yeni virüs ile ilgili ilk yayınından 3 gün önce Alman virolog Drosten, Avrupalı diğer devletlerin Halk Sağlığı Daireleri ile ortaklaşa olarak, “Gerçek zamanlı RT-PCR cihazı ile 2019’da ortaya çıkmış yeni koronavirüsü (2019-nCoV) saptama” protokolünü hazır hale getiriyor.

23 Ocak 2020: Hakemli dergi Eurosurveillance, yazarları arasında bizzat kendi editörlerinin bulunduğu (çıkar ihtilafı 1), diğer bazı yazarların da çıkacak PCR testini geliştiren firmalarla maddi ilişki içinde olduğu (çıkar ihtilafı 2) bu çalışmayı tam 24 saat içerisinde değerlendirip yayına verererek tarihe geçiyor.

Kasım ayı içerisinde, Corman-Drosten Çalışması olarak bilinen bu yayınla ilgili 10 hayati hatayı ortaya koyarak, dergiden yayını acilen geri çekmelerini talep eden 22 uzmanın değerlendirmesini buradan okuyabilirsiniz.

Çeşitli uluslardan bir araya gelerek bu tarihi fiyaskoyu (bilimsel sahtekarlık olarak okuyunuz) açığa çıkaran ekibin değerlendirme ve bulguları doğruysa, bunun implikasyonları korkunç demektir. Zira WHO’nun ucuz, hızlı ve güvenli diye dünya genelinde ülkelere kullanmak üzere önerdiği ve bugün kullanımdaki kitlerin %70’inin sahip olduğu protokol Drosten’ınki. 

Özetlersek;

  • Bugüne kadar kimse SARS-CoV-2 virüsünü gerçek manada gösterilebilmiş değil,
  • Tüm dünyada uygulamaya konulan pandemi tedbirlerinin dayandırıldığı pozitif vaka sayısını üretimeye yarayan test protokolünün geliştiricisi Prof. Christian Drosten bilimsel sahtekarlık ve dolandırıcılık suçlaması ile dava edilmek üzere.
  • Prof. Drosten gibi Türkiye’de de henüz virüsün adı konulmadan ve mevcudiyeti ispatlanmadan test kiti geliştirdiğini kabul ve ikrar etmiş uzmanlar var.
  • Gen bankasına kayıtlı dizilimler üzerinden hayali virüs için bilgisayar marifetiyle oluşturulmuş genetik materyalin yalnız çok küçük ve hemen tüm canlılarda olan bölümleri üzerinden arama yapılıyor,
  • Drosten tarafından geliştirilen protokolde aramanın kaç devirde sonlandırılacağı da belirtilmediğinden bu rakam 40-45’lere kadar çıkıp hiçbir geçerliliği olmayan yanlış pozitifler üretiyor ve üretilen bu yanlış-pozitifler üzerinden sahte ve gerçekte olmayan bir salgın varmış gibi gösteriliyor,
  • Bu yalanlar salgını sürerken de insanlık yeni dünya düzenine kademe kademe geçiriliyor.

Ve şimdi Alman avukat Reiner Fuellmich ve ekibi tarafından Prof. Christian Drosten ve WHO’ya karşı dava açılmaya hazırlanıyor

Bizde ise, Anadolu Ajansı’ndan Yeşim Sert Karaaslanın 08 Nisan 2020 tarihli haberinden öğrendiğimize göre, Halk Sağlığı Genel Müdürlüğü Daire Başkanı ve Koronavirüs Bilim Kurulu üyesi Prof. Dr. Selçuk Kılıç daha Ocak ayının ilk haftasından, Çin’in ancak 12 Ocak’ta tam genom bilgisini dünya ile paylaştığı yeni “virüs” için tanı kiti geliştirmeye başlamış. Kiminle? Bioeksen firması ile. 

Bir kamu/özel işbirliği harikası olan “yerli kit”lerimizin geliştiricisi firma yetkilileri ve sayın bilim kurulu üyemize sormak isteriz: Virüs izolasyonu veya genom bilgisi olmadan yepyeni, daha öncekilere hiç benzemeyen tuhaf belirtilere yol açtığı iddia edilen gizemli bir virüs için tanı kiti nasıl geliştirilebiliyor? Hatta Prof. Drosten ile birlikte yerli uzmanlarımızın cevaplaması gereken soruları şu şekilde genişletebiliriz de:

  • Prof. Drosten ve Prof. Kılıç, kendilerine (daha sonra) Çinli virologlar tarafından açıklanmış gen sekansları üzerine inşa ettikleri test prosedürüne geçmeden önce, bu genetik kodların virüs kökenli olup olmadığını kontrol etmişler midir yoksa Çin tarafından sağlanan bilgi hiçbir kontrolden geçmeden doğru mu kabul edilmiştir?
  • Ortaya çıkardıkları test kitlerinde tanımlanmış gen sekanslarının virüs kökenli olup olmadığını kontrol için bilimsel metodolojinin olmazsa olmaz kuralı olan kontrol deneyi yürütmüşler midir yoksa bu kural çiğnenmiş midir?
  • Bu yetkililer, yeni tip virüse ait olduğunu öne sürdükleri ancak virüsün kendisini gösteremedikleri şu durumda, elde etmiş oldukları gen sekanslarının bitkiler de dahil olmak üzere her canlının metabolizmal süreçlerinin doğal bir parçası olarak üretilen ve hastalık sürecinde bu üretimin hızlandığı da bilinen kendi genlerimize ait dizilimler olup olmadığını anlayacak şekilde kontrol deneyi yürütmüşler midir?
  • Prof. Drosten’ın 10 geni olduğu belirtilen koronavirüsün sadece 2 genindeki oldukça kısıtlı bölümleri saptamaya yarayan test prosedürüne bakarak, aktif ve hastalık yapan bütün bir virüsün mevcudiyeti anlaşılabilir mi? Prof. Kılıç’ın geliştirmiş olduğu test kitinin ise Temmuz ayında ortaya çıktığı üzere sadece tek gen üzerinden çalıştığını ve sayın uzmanımızın aynı zamanda devletin koronavirüs bilim kurulunda yer aldığını hatırlarsak, bilimsel olarak izahı mümkün olmayan bu durumun Sağlık Bakanlığı tarafından nasıl onay verilerek hayata geçirilebilmiş olduğunu sormak ve acilen kamu erişimine açık hale getirmeleri gereken Prof. Kılıç ve ekibine ait bilimsel yayınları (tabii varsa) bizzat incelemek isteriz.

WHO’nun Mart’ta pandemi ilanı ile birlikte ülkelere “Test, test, test!” emri vermesi üzerine bu şekilde daha virüsün yüzü bile görülmeden hazırlanmış tanı kitleri ile işe koyulan uzmanlarımız, birileri (doğruluğu ve güvenilirliği bir o kadar şaibeli) bir başka “uluslararası” test kiti ile karşılaştırıp yerli kitimizin “doğruluğunu” %40 olarak tespit edince (belli ki yeterince pozitif vaka üretemiyor diye) Sn. Selçuk Kılıç, Türkiye’de 20 Temmuz itibarıyla yapılmış toplam 4 milyon 273 bin 377 test sonra görevinden alınıyor. Koronavirüs bilim kurulunda da yer almakta olan profesörümüzün, tanı kitini üreten firma ile doğrudan maddi ilişkisi olup olmadığı herhalde Sağlık Bakanlığı’nca değerlendirilmiş, Alman avukat sn. Fuellmich gibi tüketici haklarını savunacak Türk avukatlar da bilimsel geçerliliği olmayan ve yanılma payı bunca yüksek bir kitin daha ilk başta gerekli kontrollerini yapmayarak kullanımına onay vermiş Sağlık Bakanlığı ile birlikte, 7 ay boyunca bu kusurlu testi kullanımda tutarak 4 milyonu aşkın uygulamadan dolayı haksız kazanç sağlamış kişi, kurum ve kuruluşlar hakkında hukuki işlemlerin başlatılması için harekete geçmiştir?  

İşte Prof. Dr. Selçuk Kılıç’ın basın organlarınca kamuya servis edilen açıklamaları:

 

 

 

KAYNAK

TÜRKİYE CUMHURİYETİ SAĞLIK BAKANLIĞI’NA SESLENİYORUZ

Ankara Üniversitesi’nden Prof. Dr. Aykut Özkul, Erciyes Üniversitesi’nden Prof. Dr. Aykut Özdarendeli ve Sağlık Bakanlığı Halk Sağlığı Genel Müdürlüğü Mikrobiyoloji Referans Laboratuvarları ve Biyolojik Ürünler Dairesi Eski Başkanı Prof. Dr. Selçuk Kılıç‘ın virüs izolasyonuna dair yapmış oldukları akademik yayınların bilimsel geçerliliğinin sınanabilmesi için Sağlık Bakanlığı tarafından ivedilikle kamuoyuyla paylaşılması gerekmekte, resmi kurumlarımızın basit bir soruya sadece yarım günde verilebilecek cevap için 30 günlük resmi yanıt verme süresinin dolmasını bekleme ve soruya tehditkar biçimde soru ile yanıt verme taktiğine başvurmamaları gerekmektedir.

Saygılarımızla.

Okumaya Devam Et

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını göstermiştir.) Sormamız gereken önemli bir soru var:Modern...

Tıpta Dolandırıcılık ve Hile: Virüs Nerede?

Tıpta Dolandırıcılık ve Hile: Virüs Nerede?

“1 devir olmuş 10 olmuş 40 olmuş, hiç mühim değil. PCR testinde devir sayısının da bir anlamı yok, zira ortada virüsün mevcudiyetine dair kanıt yok!” – Prof. Dr. Stefano Scoglio 

Evet, bu defa İspanya’dayız ve Amerika Birleşik Devletleri’nden Dr. Andrew Kaufman ile İtalya’dan Prof. Scoglio’nun farklı kulvarlardan gidip aynı sonuca ulaştıkları konuda, bu uzmanların görüş ve açıklamalarını teyit eder nitelikteki bulgularıyla söz Prof. Jesús García Blanca’da.

Hilekarlık Artık İspatlı: PCR, SARS-CoV-2 tespitine yaramıyor

242. Sayı – Kasım 2020

Covid-19’a atfedilen hastalık ve ölümlere yol açtığından şüphelenilen SARS-Cov-2’yi tespit için kullanılan PCR’lardaki gen dizilimleri, bizzat insan genomundaki düzinelerce dizilimle eşleştiği gibi, yüze yakın mikropta da bulunuyor. Ve bunlara primerler, yani taşıdıkları iddia edilen “genom”dan rastgele alınmış geniş bölümler ile “hedef genler” denilen ve bu “yeni koronavirüs”e özel olduğu iddia edilen dizilimler de dahil. Testin hiçbir hükmü yok ve bugüne kadar çıkan “pozitif”lerin mutlaka bilimsel bakımdan geçersiz ilan edilerek testi alanlara durumun iletilmesi, hayatını kaybetmiş olanların da ailelerine bu bildirimin yapılması gerekir. Zira dünyanın PCR konusunda en önde gelen isimlerinden Stephen Bustin bile, uygun koşullarda PCR ile sonucu pozitif çıkmayacak kimsenin olmadığını ifade ediyor!

Mart’tan bu yana sizleri uyarıyoruz: sizde var mı yok mu anlamak için baktığınız virüsün bileşenleri nedir, neye benzemektedir bilmeden, buna özel test filan geliştiremezsiniz. Virüsün bileşenlerinin neye benzediğini de o virüsü bulup, diğer her şeyden ayrı olarak tek başına ortaya koymadan (saflaştırma/izolasyon) bilebilmenizin imkanı yok. Biz de bu süreçte SARS-CoV-2 denilen virüsün kimse tarafından izole edilmemiş olduğuna ve hatta geçtiğimiz haftaki sayımızda açıkladığımız nedenlerden dolayı böyle bir şeyin (virüs izolasyonu) mümkün de olmadığına dair kanıtları biriktirmeye devam ediyoruz. (Lütfen –www.dsalud.com- sitesinden “Patojenik virüs diye bir şey olduğunu ispat edebilir misiniz?” başlıklı yazımızı okuyunuz). 

Bu raporda da RT-PCR testinin, SARS-CoV-2 denilen şeyi değil, insana ait RNA parçacıkları ile çok sayıda mikropça da taşınmakta olan RNA fragmanlarını bulmakta olduğuna dair yeni verileri sunuyoruz. RT-PCR’ın çok sayıda kurum/kuruluş, WHO ya da CDC gibi resmi ve idari birimler ve dünyada otorite olarak kabul edilen Dr. Stephen Bustin gibi uzmanlarca da kabul edilen türlü problemlerine değinmiş, Bustin’in, çıkan sonuçların yorumlanmasında kullanılacak kriter seçimindeki rastgeleliği de, cihaza yaptırılacak devir sayısı seçimini de tamamen saçma olarak nitelendirdiğinden, çünkü bu şekilde kimi test ederseniz edin pozitif çıkma ihtimali doğurduğundan bahsetmiştik. Bu raporla da, var olduğu iddia edilen SARS-CoV-2 virüsü ve WHO’nun RT-PCR kullanımına dair yönerge ve protokolleri üzerine yapılmış özel bir araştırmanın sonuçlarının yanısıra, geri kalan tüm “insan koronavirüsleri” için toplanmış verileri de sizlerle paylaşmak istiyoruz.

İnsan koronavirüsü” olarak kayda geçen virüslerin yedisinin de izolasyonu gerçekleştirilmemiş!

Araştırmalarımız sonucu ortaya çıkan bulgu ise fazlasıyla ciddi: “İnsan koronavirüsü” olarak kayda geçen virüslerin yedisinin de izolasyonu gerçekleştirilmemiş ve bunları tetkik için kullanılan PCR’lerdeki primerlerin gen dizilimlerinin tamamı ile, virüs genomuna ait diye sunulan genetik fragmanların büyük kısmı bizzat insan genomunun farklı yerlerinde bulunan, ayrıca isimlerini vereceğimiz şu bakteri ve arkelerin genomunda da mevcut olan dizilimler çıkmıştır: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis ve daha niceleri. Bizi bu umulmadık sonuca götüren araştırmayı şimdi sizlere adım adım açıklayacağız.

Koronavirüslerinin herhangi bir tanesi izole edilmiş mi?

Nisan ayının birinci yarısında gerçekleştirdiğimiz ilk incelemede SARS-CoV-2’nin izole edilmemiş olduğunu fark edip, izolasyon yaptıklarını öne sürenlerin ise bunu önceki “insan koronavirüsleri”ne ait “izolat”lara dayanarak ileri sürmekte olduklarını görünce, bahsi geçen bu önceki virüs izolatlarına ait literatürü, iddiaların doğruluğunu sınamak için mercek altına almaya karar verdik. İncelediğimiz insan koronavirüsleri şunlar: 229E (1965’te izole edilmiş olduğu öne sürülmekte), OC43 (1967), SARS-CoV (2003), NL63 (2004), HKU1 (2005) ve MERSCoV (2012). Elde ettiğimiz sonuçlar ise şu şekilde:

Koronavirüs 229E. 

Referans yayın: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1: 190-193. January 1, 1966. 

Bu yazarlar, kullanmış oldukları ‘Kompleman Fiksasyonu’* denilen izolasyon metodundan bahsederken başka yayınlara atıfta bulunmuş olduklarından, metodu anlamak için verdikleri atıflardan birine baktık: Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5): 931-938, May 1965. Antijen-antikor reaksiyonundan hareketle bu ikiliden herhangi birini tespite yarayan, ancak tedavülden kalkmış bir prosedür bu. Burada, yeni virüs olarak lanse edilen yapının antijenleri aranıyor, ancak daha önce de açıkladığımız gibi, bunun için denklemde bulunması gereken virüse-özel antikorlar virüsle ilk defa karşılaşılıyorsa zaten ortada yoktur. 

*Kompleman Fiksasyonu: İng. Complement Fixation. Antijen ve antikorun karşılıklı etkileşimi ile komplemanın aktive oluşu ve antijen-antikor kompleksine bağlanışı; kompleman bağlanması; kompleman tespiti

Koronavirüs OC43. 

Referans yayın: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub. 

Bu yayında, kültürlerden alınıp virüs RNA’sıdır diye ortaya konmuş yapının virüsten geldiğini gösterir hiçbir kanıt bulunmamakta. Deneyde kullanılan QIAamp kiti adlı cihaz miyarları**, inhibitörleri ve kirleticileri temizliyor temizlemesine, ancak yapamadığı şey, çıkan RNA’nın nereden geldiğini belirlemek. Ve deneyde kontrol düzeneği de kullanılmamış. Ardından ise PCR ile büyültülüp, virüs genetik bilgisi olduğu varsayımı (!) ile dizilimi ortaya konmuş. Ve yayın yazarın, mevzubahis şey bir “virüs”müş gibi, bu intibaı verecek şekilde (halbuki tamamen ispatsız) mutasyonlardan, yeniden kombinasyonlara gitmelerden, genotiplerden, moleküler evolüsyondan, suşlardan ve viroloji jargonu içeren diğer şeylerden bahisle yaptığı spekülasyonlar ile son buluyor.  

**Miyar: İng. Reagent. Bir maddenin varlığını ya da niteliğini belirleme amacıyla çözeltiye ilave edilen madde; miyar; ayıraç

SARS-CoV Koronavirüsü.

Referans yayın: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

Yayında pürifikasyonun sözü edilmiyor. Filtrasyon veya santrifüjlemenin bahsi dahi geçmiyor. Söylenen tek şey virüslerin, iki hastaya ait nazofarengeal aspiratlar ile akciğer biyopsilerinin yavru maymundan alınmış karaciğer hücrelerinde oluşturmuş kültürden izole edilmiş olduğu. Kontrol olarak kullanılan herhangi bir düzenek yine yok. Bir tek bir “sitopatik etki”den [hücre yapısında değişiklik, bozulma] bahsediliyor, o da virüse atfediliyor, varlığı bilinen virüs ve retrovirüslere PCR ile baktık ve bir sonuç elde edemedik deniyor. En sonunda bir RT-PCR’a girişiliyor, bunda da “rasgele seçilmiş inisiyatörler” [başlatıcılar] kullanılıyor ve “kaynağı bilinmeyen” [neye ait olduğu, nereden geldiği belli olmayan] bir gen dizilimi saptanıyor. Bununla ilgili olarak da, “koronavirüs ailesi ile zayıf bir homoloji” [benzeşme] tespit ediliyor. Sonra bu gen dizilimi için primerler hazırlıyorlar ve test etitkleri 44 SARS hastasından yalnız 22’si pozitif çıkıyor.

Koronavirüs NL63. 

Referans yayın: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004. 

Yazarlar şöyle diyor: “Kimliği bilinmeyen patojenlerin neye ait olduğunu moleküler biyoloji gereçleri ile bulmak zor, zira hedef dizilimin ne olduğu bilinmediğinden PCR’ye özel inisiyatörler  de [başlatıcılar] hazırlanamıyor.”

Burada VIDISCA adlı kendi geliştirmiş oldukları ve dizilimin ne olduğunu bilmeye gerek bırakmadığını iddia ettikleri bir gereç kullanmışlar! Böyle bir şey mümkün olabilir mi? Yapılan şey tam olarak nedir, bir bakalım: Önce kültür hazırlanıyor ve görülen “sitopatik etki”ye dayanılarak ortamda virüs olduğuna kanaat getiriliyor. Bu metodun getirdiği yenilik şu; nükleik asit moleküllerini mutlaka aynı uzunlukta olacak şekilde belirli yerlerinden kesen ve ismine “kısıtlama enzimleri” [restriction enzymes] denilen bir tür enzim kullanıyorlar. Bu enzimlere maruz bırakıldıktan sonra ortaya çok sayıda aynı veya oldukça benzeşen DNA veya RNA bölümleri çıkıyorsa, o zaman bu virüsten gelmiştir diyorlar. Burada da, canlı konağın genomu olsa birbirine benzemeyen dizilimde fragmanların ortaya çıkması lazım ama virüs öyle değil, virüs kendini kopyalayarak çoğaldığından birbirinin aynı dizilim parçaları görülüyorsa, bu olsa olsa virüs kaynaklıdır mantığı güdüyorlar. Peki ama bu çıkarım doğru mu? Elbette değil! Bu varsayım (ki ortada bir virüs olduğu varsayımının üzerine yapılmış ikinci varsayımdır bu), “virüs benzeri partiküller”, “retrovirüs benzeri partiküller”, “endojen retrovirüsler”, “eksozomlar”, “vücut hücrelerinin dışında kalan alanlardaki” partiküller ve hatta mitokondriyel DNA mevcudiyetini hiç hesaba katmamakta. “Virüs”lerle aynı kapasitede üreme özelliği gösteren dünya kadar partikül bulunmakta ve bunlar enzimle kesildikten sonra ortaya çıkarmış oldukları birbirinin aynı kopyalarla testte yanıltıcı sonuç çıkmasına neden olabilir. VIDISCA’da kullanılan teknikle ilgili kaleme alınmış “Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery” başlıklı makalede de bahsini ettiğimiz bu açık ele alınmaktadır. Virus Research (Virüs Araştırmaları) dergisinin 2 Nisan 2019 tarihli 263. sayısında Cormac M. Kinsella et al. tarafından kaleme alınmış makalede geçen şu ifadeyle de bu gerçek kabul edilmektedir: “VIDISCA insert’ünde konağın sağladığı arkaplan nükleik asitten fazlası, ‘virüs benzeri’ karakteristikleri olması (yani mitokondriyel DNA’da olduğu gibi fazla sayıda kopya üretebilme yeteneği) haricinde, beklememektedir.”

Koronavirüs HKU1. 

Referans yayın: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005. 

İnanılır gibi değil ama makale şu sözlerle açılıyor: “Solunum yolları enfeksiyonlarından mustarip hastalar üzerinde bugüne kadar yürütülmüş yoğun ve detaylı araştırmalara rağmen, hastaların önemli bir bölümünde mikrobiyolojik bir nedene rastlanmamıştır. RNA, saf hale getirilmemiş kültürlerden çıkarılmaktadır.” Ve burada da koronavirüs genlerinin bulunduğu bir PCR kullanılıyor. Sekanslama (gen diziliminin oluşturulması) için familya, domain, fonksiyonel yerleşkelere göre düzenlenmiş iki protein veritabanı -PFAM and INterProScan- ile birlikte, nükleotidlerin nasıl birleşmesi gerektiği üzerine “tahmin” yürütmede kullanılan iki de bilgisayar programından yararlanılıyor. Yayında şu ifadeler de geçiyor: “Genler tarafımızdan manuel olarak bir araya getirilip sekanlanslanmış olup, ardından da virüs genomuna ait dizilime son halini vermek üzere düzeltme yapılmıştır [editing].” Ve bu çalışmada da herhangi bir kontrol düzeneği görmüyoruz.  

MERS-CoV Coronavirus. 

Referans yayın: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012. 

Genetik materyal, High Puré Viral Nucleic Acid Kit adlı bir gereçle doğrudan kültür üst fazı ve balgam numunesinden ekstrakte edilip ardından da farklı PCR’larla, bilinen türlü mikroorganizmalarla eşleşiyor mu diye bakılıyor. Pürifikasyon yapıldığına dair bir bildirim göremiyoruz yayında ve kontrol düzeneği yine yok

Kısacası, daha ilk koronavirüslerden itibaren (ve “virüs” olduğu öne sürülen diğer diğer pekçoğu için de) yapılmış olan şey şu: Enfekte olduğu varsayılan (her ne “sitopatik etki” gözlemleniyorsa bunun bir tek virüs mevcudiyetine bağlı oluşabileceği varsayılıyor) dokular kültürlenip ya buradan birtakım proteinler elde ediliyor ve hiçbir teste filan tabi tutulmadan “virüs antijenleri” ilan ediliyorlar ve sonra bu “antijenler” olur da doku kültürlerinde de çıkarsa [burada tespit edilirse] bunu da “izolasyon”dan sayıyorlar veyahut da, virüse ait olduğu önkabulüyle kültürden birtakım nükleik asit fragmanları çıkarılıyor [ekstraksiyon].    

Bir önceki sayıda yer verdiğimiz makaleden hatırlayacağınız gibi, Dr. Stefan Lanka’ya göre bu “sitopatik etki” denilen şey esasında bizzat kültürün içine sokulduğu koşullardan kaynaklanmakta. Bu durum, Andrea Németh ve arkadaşlarının 15 Ağustos 2017 tarihinde Nature dergisinde yayına giren Antibiyotik uygulamasına bağlı olarak açığa çıkan, yüzeyle ilintili DNA’ya sahip küçük ekstraselüler [hücredışı] veziküller (eksozomlar) başlıklı yayınlarında da tanımlanmış durumda.  

Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf)

Burada açıklandığına göre, laboratuvar deneyi [in-vitro deney] yapılırken hücre kültürüne dışarıdan eklenen bazı maddeler, örneğin antibiyotikler, oluşturduğu stresle daha önce kültürde varlığı saptanmayan yeni birtakım gen dizilimlerinin ortaya çıkmasına neden olabilmekte. Bu durumun, 1983’te Nobel ödülünü kabul konuşmasında bizzat Dr. Barbara McClintock tarafından da dile getirilmiş olduğunu hatırlatalım. 

https://www.nobelprize.org/uploads/2018/06/mcclintocklecture.pdf

İşin özü şu ki, İNSANA AİT KORONAVİRÜS OLARAK ADDEDİLEN YEDİ VİRÜS DE GERÇEKTE İZOLE EDİLMEMİŞTİR. Birbirlerinden tek farkları kullanılan laboratuvar prosedür ve teknikleridir, ki bunlar da gitgide daha sofistike hale gelmiş, ancak bu sofistikasyon daha doğru sonuçlar elde etmek olarak değil, kanma ve kandırmacaya daha müsait bir zemin oluşturma olarak tezahür etmiş, bu durum SARS-CoV-2 diye bir şeyin kağıt üzerinde yoktan var edilmesi, resmen icat edilmesi ile doruk noktasına ulaşmıştır. 

Böyle bir virüs izole filan edilmemişse, buradan çıkacak sonuç bittabii ki bu tür “koronavirüsler”in herhangi bir hastalığın sorumlusu olarak gösterilemeyeceğidir. Dahası, bahsi geçen “virüsler”e ait olduğu öne sürülen yapı ve bölümler (nükleik asitler veya proteinler) üzerinden düzenlenmiş her ne tür test düzeneği olursa olsun hiçbir şekilde ne “enfeksiyon testi” olma vasfına ne de “tanı testi” olma hükmüne sahiptirler.

YANITSIZ KALAN SORULARA YENİLERİ EKLENİYOR 

Önceki sayıda, SARS-CoV-2 “virüs”ünü izole ettiklerinden bahseden bilimsel yayınların yazarlarına yöneltilmiş sorulara gelen yanıtların derlemesini sunmuştuk. Bu yazarlar virüs için “saflaştırma” prosesinin yapılmamış olduğunu kabul ve ikrarla, esasen virüsün izole de edilmemiş olduğunu kabul etmiş oldular. Ve şimdi bu kanıtlara bir yenisini daha ekliyoruz: Farklı ülkelerin resmi yetkililerince (siyasi idare ve sağlık bakanlıkları nezdinde) SARS-CoV-2 izolasyonu ve pürifikasyonuna [saflaştırma] dair sorgulamalara verilmiş yanıtlar.  

James McCumiskey’den –Son Tezgah: Biyomedikal Paradigma (The Latest Conspiracy: The Biomedical Paradigm) kitabının yazarı- öğrendiğimize göre, İrlanda Milli Virüs Referans Laboratuvarı konuyla ilgili Dublin Üniversitesi‘nden bilgi istiyor, üniversite ise “talebe cevaben verebilecekleri bir kaydın bulunmadığı” yanıtını veriyor. Laboratuvarın hukuki hizmetler birimi direktörü ısrarcı olunca üniversitenin yanıtı şu oluyor: “Üniversite olarak, akademik konuların Bilgi Edinme Hakkı Kanunu gereğince sorgulamaya tabi tutulamayacağı görüşündeyiz.” Milli Virüs Referans Laboratuvarı’nın yapmış olduğu bilgi talebinden şunu anlıyoruz ki, üniversite SARS-CoV-2’yi izole etmiş ve buradan kültürlemeye gitmiş değil. Kabul ve ifade ettikleri tek durum, “diagnostik numunelerde SARS-CoV-2 RNA’sı saptanmış” olması.  

22 Haziran’da bir grup uzman benzer bir sorgulamayı doğrudan İngiltere başbakanı Boris Johnson‘a yapmıştı. Mektupta imzası olanlardan Dr. Kevin Corbett (Imperial College’da akademisyen) ve Piers Corbyn (mühendis, bağımsız araştırmacı) ile o dönemde yaptığımız söyleşiyi de yayımlamıştık. Bunun dışındaki imza sahipleri ise David Crowe, Dr. Andrew Kaufman, Edinburgh’da biyoloji profesörü Roger Watson ile kimyager David Rasnick idi. Bu isimler ortak sorgularına hala bir yanıt alabilmiş değiller! 

Benzer bir başka sorgu, bu defa Kanada’nın Milli Araştırmalar Konseyi’ne yapışmış ve aldıkları cevap şu: “MAK’deki kayıtlar bütünüyle incelenememiş olduğundan üzülerek bildirmek istiyoruz ki, talebinize cevap olabilecek yayın bulunamamıştır.

Buna Kanada, Avustralya, Yeni Zelanda, Avustralya, Almanya, Birleşik Krallık ve Amerika Birleşik Devletleri’nde ‘Bilgi Edinme Hakkı Kanunu’ çerçevesinde benzer sorgulamalarda bulunmuş iki gazeteciyi de eklememiz lazım, zira 5 Eylül itibariyle on iki resmi kurum yapılmış başvuruya yanıt vermiş durumda ve hepsi de aynı şeyi söylüyor; ellerinde Covid 19’a yol açmış olması lazım gelen virüsün izolasyonunu tarif eden çalışma kaydı yok. Sorulara verilen resmi yanıtların detayları şuradan görülebilir: https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-ofcovid-19-virus-isolation/ 

DÜZMECE GENOMUN ÇIKIŞ NOKTASI NERESİ

Bu durumda kendimize sorduğumuz soru şu oldu: Tıbbi yayınlarda bahsi edilen gen dizilimleri -iddia edildiği gibi- yeni birtakım virüslere ait değilse, nereden çıkmış olabilirler? Bu sorunun cevabını bulmak için de, verili gen dizilimini Birleşik Devletler’in Milli Sağlık Enstitüleri’nde kayıtlı tüm dizilimlerle kıyaslamamıza olanak verecek bir ‘dizilim sırası arama gereci’ olan Basic Local Alignment Search Tool (BLAST) adlı bir bilgisayar programı kullandık. (ABD’nin milli sağlık enstitüleri kamusal erişime açık olup şuradan sorgulama yapılabiliyor: https://blast.ncbi.nlm.nih.gov/Blast.cgi.)  Neyi nasıl yaptığımızı burada sizlere adım adım anlatacağız ki, okurlarımız da girip aratsın ve sonuçların sağlamasını yapabilsin. 

Önce WHO’nun internet sitesinde o zaman gösterilmekte olan protokollerde tanımlı PCR inisiyatörlerinin [başlatıcılar] hepsini topladık:  

– Çin CDC’sinin protokolü: hedef olarak ORF1ab ve N genlerini kullanıyor.

– Fransa’nın Pastör Enstitüsü’ne (Pasteur Institute) ait protokol: RdRP geninin iki fragmanını kullanıyor (RdRP geninin SARS-CoV-2’ye özel bir gen olduğu iddiası var). 

– Birleşik Devletler CDC’sinin protokolü: N geninden üç fragman (parça, bölüm) kullanıyor. 

– Japonya’nın Milli Enfeksiyon Hastalıklar Enstitüsünün protokolü: Diğer koronavirüsler ile ortak olduğu öne sürülen diğer genlerin yanırısa, hedef olarak S genini kullanan tek protokol bu.  

– Charite Protokolü (Almanya): E, N ve RdRP genlerini kullanıyor. 

Hong Kong Üniversitesi‘nin Protokolü: ORF1b-nsp14 ve N genini kullanıyor.

– Tayland Milli Sağlık Enstitüsü protokolü: N genini kullanıyor.

Ardından BLAST programına primerlerin dizilimlerini (aranan dizilimin başı ve arama yönüne göre de sonunu gösteren sekanstır bu) girdik ve bunları hem mikrop hem de insan genomlarının toplamından oluşan iki veritabanında arattık.

SARS-COV-2’DİR DENİLEN SEKANSLAR HEM İNSAN HEM DE MİKROP GENOMUNDA OLAN SEKANSLAR!

Fransızların protokolündeki inisiyatörlerden örnekle, prosedürün nasıl işlediğinin ayrıntısına girelim. İnternetten BLAST programının sitesine girdikten sonra, mikrobiyel genom veritabanında arama yapmak için Microbes’u seçtik ve sonraki sayfaya geçtik. Sonra, ekrana gelen formda ilgili yere, Fransızların protokolünün düz inisiyatörüne ait dizilimi (ATGAGCTTAGTCCTGTG) girdik. Yakınen benzeşen (“highly similar”) dizilimler seçeneğini işaretledik ve BLAST tuşuna batık. Birkaç saniyede sonuçlar ekrandaydı, ekran görüntüsünü aldık (1 no’lu resim) ve kimliği %100 bilinen mikropların gen dizilimlerinden oluşan ve girdiğimiz hedef dizilim ile %77 ila %100 oranında örtüşen 100 adet mikroba -bilhassa bakteri ve arkeye- ait gen dizilimi çıktı karşımıza.  

Buradan tekrar ana sayfaya geçip, bu defa da İnsan (Human) seçeneğini işaretleyip aynı dizilimi insan genomunda arattık ve birkaç saniyede ekrana gelen sonuçların yine ekran görüntüsünü (2 no’lu resim) aldık. Meğer bu gen diziliminin %66 ila %100 oranları arasında eşleştiği ve bilinirliği %100 olan tam 74 dizilim varmış insan genomunda. 

SARS-CoV-2’ye özeldir denilen bu PCR başlangıç primeri, insan genlerindeki 74 kısımla örtüştüğü yetmiyormuş gibi, mikrop genlerine ait fragmanların da 100’üyle çakışıyor!

Bir de testen yazıldığındaki (bitiş) primeri (CTCCCTTTGTGTGTGT) için aynı işlemi tekrarladığımızda sonuçlar benzer çıktı.

Bunlar oldukça kısa dizilimler (sekans) olduğundan (topu topu yirmi kadar genetik harf yahut nükleotidden oluşuyorlar), bir kez daha arama yapalım ama bu sefer bu iki primerle başlayıp biten hedef sekansa (yani SARS-CoV-2’ye ait olduğu iddia edilen genomun, başta ve sonda bulunan bu iki primer arasında kalan bölümüne) bakalım istedik. Bunu yapabilmek için de haliyle, resmi makamlarca “SARS-CoV-2 genomu” ilan edilmiş dizilime ihtiyacımız var. Biz bu virüsü izole ettik ve sekansladık diye ortaya çıkan binlerce laboratuvar var (ki önceki raporlarda açıkladığımız gibi asılsız iddialardır bunlar), ancak biz Milli Biyoteknoloji Bilişim Merkezi’nin internet sitesini (https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2? report=genbank&to=29903) tercih ettik. Siteye girdiğimizde “hedef dizilim”i bulduk; “genom”un 12,690 ve 12,797 konumları arasında kalan 108 nükleotidlik bir fragmandı bu: ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACAACAACAAAGGGAG

Bu defa da bu dizilimle yukarıda anlattığımız işlem basamaklarını aynen tekrar ettiğimizde sonuç yine şaşırtıcıydı, zira mikrop genlerinden %100 eşleşme gösteren yüz adet dizilim de burada çıktı, yanında da insan genomundan %83 ila %95’lik benzeşme oranı ile dört dizilim bulduk. Bundaki eşleşme sayısı daha az evet, fakat burada önemli olan, SARS-CoV-2 diye servis edilen “hedef dizilim”e ait bölümleri istikrarlı şekilde hem mikroplarda hem de kendi genomumuzda buluyor olmamız.

Hayretler içerisinde, bari bir de bu virüsün en belirgin ve kati genidir denilen ve zarf proteinlerinin üretiminden sorumlu olduğu öne sürülen, yeri 26,245 ve 26,472 konumları arasındaki bölüm olan E genini girip aratalım diye düşündük. Bahsi geçen E geni şu: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA.

Aynı işlemler üzerinden bu geni arattığımızda sonuç daha da şaşırtıcı oldu. Bunca uzun bir dizilim olmasına rağmen kimliği %100 tanımlanabilen 100 adet mikrop sekansı da bununla eşleşti, üstüne de %80 ila %100’lük eşleşme oranıyla insan genomuna ait 10 dizilim bulundu. Rastgele aldığımız bir gen bölümünden yine benzer sonuç aldık, ayrıca bir de SARS-CoV-2 nükleokapsidinin proteinlerine karşılık geliyor dedikleri N genine baktığımızda da yine benzer eşleşmeler gördük.

Son olarak bir de şu hücre içine girmede kilit roldeki yapısal “spike” proteinlerini yapıyor, o bakımdan da SARS-CoV-2’nin en spesifik genidir dedikleri S genini test edelim dedik. Bu, 21,563. ve 25,384. konumlar arasındaki 3821 nükleotidden oluşan çok daha uzun bir dizilim olduğundan iki yerden rastgele seçtiğimi bölümlerini alıp arattık ve arattığımız ilk bölüm (TTGGCAAAATTCAAGACTCACTTTC) bir diğer 100 mikrop geni sekansı ile 93 de insan gen sekansına karşılık geldi, ikinci bölüm (CTTGCTGCTACTAAATGCAGAGTGT) de mikrobiyel gen sekanslarından 100’ü ile isan gen sekanslarının 90’ıyla eşleşti. 

S genini hedef dizilim olarak kullanan tek ülke olduğundan Japon Protokolü’nün inisiyatörleriyle araştırmamızı sonlandıralım istedik ve okuyucunun çoktan tahmin etmiş olacağı üzere bunda da oldukça yakın sonuçlar elde ettik: mikroplara ait gen dizilimlerinden 100’ü ile, aidiyet oranı %94.12 ila %100 arasında değişen, insana ait 93 gen dizilimi ile örtüşme!

SONUÇ 

Tüm bu anlattıklarımızdan çıkarımlanacak sonuç gayet açık: SARS-CoV-2 TESPİTİ YAPMADA KULLANILACAK GEÇERLİ TEST YOK DÜNYADA; ne antikor veya antijen testi ne de RT-PCR. S1 diye geçen spike proteinini kodladığı iddia edilen gen üzerinden çalışanları da dahil ettik. Yani bu tam olarak şu demek: TÜM BU “VAKA”, “ENFEKTE İNSAN”, “HASTA”, “ASEMPTOMATİK” YAHUT “COVID-19 ÖLÜMÜ” SAYI VE İSTATİSTİKLERİNİN HİÇBİR BİLİMSEL TEMELİ YOK VE TÜM “POZİTİFLER” DE HATALI POZİTİF. Bu bilginin insanlara bir an evvel verilmesi, sorumluların da kanun önünde hesap vermesi lazım. 

Bu bölümü kapatırken, WHO’nun bile bu testlere itimadının olmadığını eklemek istiyoruz. Bunun için 11 Eylül’de SARS-CoV-2 laboratuvar kılavuzu olarak yayımladıkları belgeye bakmak kafi (Diagnostic tests for SARS-CoV-2https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve). Sayfa 5’te aynen şu söyleniyor: “Şüpheli aktif enfeksiyon vakaları mümkün mertebe RT-PCR gibi bir nükleik asit amplifikasyon testi (NAAT) ile test edilmelidir. NAAT testlerindeki hedef gen SARS-CoV-2 genomundan olmalıdır, lakin şu anda dünyada SARS-CoV-1 dolaşımı sözkonusu olmadığından, hedef olarak bir Sarbekovirüs dizilimi de (aralarında SARS-CoV-1 ve SARS-CoV-2 de olmak üzere insan ve hayvan koronavirüslerinden en az beşini ihtiva ettiği düşünülen virüs dizilimi) kullanılabilir.” Yani WHO, SARS-CoV-2 tetkiki için non-spesifik dizilim kullanımını onaylıyor. 

Sırf bu da değil, kılavuzda daha sonra deniyor ki, “Optimal teşhis, SARS-CoV-2 için genomdan bağımsız en az iki hedefin tanımlı olduğu bir NAAT testi ile yapılmalı, ancak hastalık bulaşının yaygın olduğu yerlerde teşhis için basit bir ‘tek hedefli’ algoritma da kullanılabilir.”

WHO kılavuzunda göre , “Bir veya iki negatif sonuç alınmış olması SARS-CoV-2 enfeksiyonu olmadığı anlamına gelmez. Enfekte bir bireyde sonucun negatif çıkmasına neden olabilecek çok sayıda faktör vardır, bunlar arasında örneğin alınan numunenin düşük kalitede olması, geç aşamada alınmış olması, düzgün muhafaza edilmemesi yahut testle ilgili virüsün mutasyona uğraması veya PCR inhibasyonu gibi teknik nedenler sayılabilir.”

Soruyoruz. Bu ülkenin hakimleri savcıları harekete geçmek için ne bekliyor?

Jesus Garcia Blanca 

Not: Yazar, bilimsel makale taraması ve BLAST programı ile girişilen ziyadesiyle ayrıntılı ve emek isteyen çalışmalardaki sabrı ve yardımları için Juan Pedro Aparicio Alcaraz’a teşekkür eder.

Raporun yayımlandığı adres: https://www.dsalud.com/revistas/numero-242-noviembre-2020/

Okumaya Devam Et

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını göstermiştir.) Sormamız gereken önemli bir soru var:Modern...