Tıpta Dolandırıcılık ve Hile: Virüs Nerede?

Tıpta Dolandırıcılık ve Hile: Virüs Nerede?

“1 devir olmuş 10 olmuş 40 olmuş, hiç mühim değil. PCR testinde devir sayısının da bir anlamı yok, zira ortada virüsün mevcudiyetine dair kanıt yok!” – Prof. Dr. Stefano Scoglio 

Evet, bu defa İspanya’dayız ve Amerika Birleşik Devletleri’nden Dr. Andrew Kaufman ile İtalya’dan Prof. Scoglio’nun farklı kulvarlardan gidip aynı sonuca ulaştıkları konuda, bu uzmanların görüş ve açıklamalarını teyit eder nitelikteki bulgularıyla söz Prof. Jesús García Blanca’da.

Hilekarlık Artık İspatlı: PCR, SARS-CoV-2 tespitine yaramıyor

242. Sayı – Kasım 2020

Covid-19’a atfedilen hastalık ve ölümlere yol açtığından şüphelenilen SARS-Cov-2’yi tespit için kullanılan PCR’lardaki gen dizilimleri, bizzat insan genomundaki düzinelerce dizilimle eşleştiği gibi, yüze yakın mikropta da bulunuyor. Ve bunlara primerler, yani taşıdıkları iddia edilen “genom”dan rastgele alınmış geniş bölümler ile “hedef genler” denilen ve bu “yeni koronavirüs”e özel olduğu iddia edilen dizilimler de dahil. Testin hiçbir hükmü yok ve bugüne kadar çıkan “pozitif”lerin mutlaka bilimsel bakımdan geçersiz ilan edilerek testi alanlara durumun iletilmesi, hayatını kaybetmiş olanların da ailelerine bu bildirimin yapılması gerekir. Zira dünyanın PCR konusunda en önde gelen isimlerinden Stephen Bustin bile, uygun koşullarda PCR ile sonucu pozitif çıkmayacak kimsenin olmadığını ifade ediyor!

Mart’tan bu yana sizleri uyarıyoruz: sizde var mı yok mu anlamak için baktığınız virüsün bileşenleri nedir, neye benzemektedir bilmeden, buna özel test filan geliştiremezsiniz. Virüsün bileşenlerinin neye benzediğini de o virüsü bulup, diğer her şeyden ayrı olarak tek başına ortaya koymadan (saflaştırma/izolasyon) bilebilmenizin imkanı yok. Biz de bu süreçte SARS-CoV-2 denilen virüsün kimse tarafından izole edilmemiş olduğuna ve hatta geçtiğimiz haftaki sayımızda açıkladığımız nedenlerden dolayı böyle bir şeyin (virüs izolasyonu) mümkün de olmadığına dair kanıtları biriktirmeye devam ediyoruz. (Lütfen –www.dsalud.com- sitesinden “Patojenik virüs diye bir şey olduğunu ispat edebilir misiniz?” başlıklı yazımızı okuyunuz). 

Bu raporda da RT-PCR testinin, SARS-CoV-2 denilen şeyi değil, insana ait RNA parçacıkları ile çok sayıda mikropça da taşınmakta olan RNA fragmanlarını bulmakta olduğuna dair yeni verileri sunuyoruz. RT-PCR’ın çok sayıda kurum/kuruluş, WHO ya da CDC gibi resmi ve idari birimler ve dünyada otorite olarak kabul edilen Dr. Stephen Bustin gibi uzmanlarca da kabul edilen türlü problemlerine değinmiş, Bustin’in, çıkan sonuçların yorumlanmasında kullanılacak kriter seçimindeki rastgeleliği de, cihaza yaptırılacak devir sayısı seçimini de tamamen saçma olarak nitelendirdiğinden, çünkü bu şekilde kimi test ederseniz edin pozitif çıkma ihtimali doğurduğundan bahsetmiştik. Bu raporla da, var olduğu iddia edilen SARS-CoV-2 virüsü ve WHO’nun RT-PCR kullanımına dair yönerge ve protokolleri üzerine yapılmış özel bir araştırmanın sonuçlarının yanısıra, geri kalan tüm “insan koronavirüsleri” için toplanmış verileri de sizlerle paylaşmak istiyoruz.

İnsan koronavirüsü” olarak kayda geçen virüslerin yedisinin de izolasyonu gerçekleştirilmemiş!

Araştırmalarımız sonucu ortaya çıkan bulgu ise fazlasıyla ciddi: “İnsan koronavirüsü” olarak kayda geçen virüslerin yedisinin de izolasyonu gerçekleştirilmemiş ve bunları tetkik için kullanılan PCR’lerdeki primerlerin gen dizilimlerinin tamamı ile, virüs genomuna ait diye sunulan genetik fragmanların büyük kısmı bizzat insan genomunun farklı yerlerinde bulunan, ayrıca isimlerini vereceğimiz şu bakteri ve arkelerin genomunda da mevcut olan dizilimler çıkmıştır: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis ve daha niceleri. Bizi bu umulmadık sonuca götüren araştırmayı şimdi sizlere adım adım açıklayacağız.

Koronavirüslerinin herhangi bir tanesi izole edilmiş mi?

Nisan ayının birinci yarısında gerçekleştirdiğimiz ilk incelemede SARS-CoV-2’nin izole edilmemiş olduğunu fark edip, izolasyon yaptıklarını öne sürenlerin ise bunu önceki “insan koronavirüsleri”ne ait “izolat”lara dayanarak ileri sürmekte olduklarını görünce, bahsi geçen bu önceki virüs izolatlarına ait literatürü, iddiaların doğruluğunu sınamak için mercek altına almaya karar verdik. İncelediğimiz insan koronavirüsleri şunlar: 229E (1965’te izole edilmiş olduğu öne sürülmekte), OC43 (1967), SARS-CoV (2003), NL63 (2004), HKU1 (2005) ve MERSCoV (2012). Elde ettiğimiz sonuçlar ise şu şekilde:

Koronavirüs 229E. 

Referans yayın: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1: 190-193. January 1, 1966. 

Bu yazarlar, kullanmış oldukları ‘Kompleman Fiksasyonu’* denilen izolasyon metodundan bahsederken başka yayınlara atıfta bulunmuş olduklarından, metodu anlamak için verdikleri atıflardan birine baktık: Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5): 931-938, May 1965. Antijen-antikor reaksiyonundan hareketle bu ikiliden herhangi birini tespite yarayan, ancak tedavülden kalkmış bir prosedür bu. Burada, yeni virüs olarak lanse edilen yapının antijenleri aranıyor, ancak daha önce de açıkladığımız gibi, bunun için denklemde bulunması gereken virüse-özel antikorlar virüsle ilk defa karşılaşılıyorsa zaten ortada yoktur. 

*Kompleman Fiksasyonu: İng. Complement Fixation. Antijen ve antikorun karşılıklı etkileşimi ile komplemanın aktive oluşu ve antijen-antikor kompleksine bağlanışı; kompleman bağlanması; kompleman tespiti

Koronavirüs OC43. 

Referans yayın: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub. 

Bu yayında, kültürlerden alınıp virüs RNA’sıdır diye ortaya konmuş yapının virüsten geldiğini gösterir hiçbir kanıt bulunmamakta. Deneyde kullanılan QIAamp kiti adlı cihaz miyarları**, inhibitörleri ve kirleticileri temizliyor temizlemesine, ancak yapamadığı şey, çıkan RNA’nın nereden geldiğini belirlemek. Ve deneyde kontrol düzeneği de kullanılmamış. Ardından ise PCR ile büyültülüp, virüs genetik bilgisi olduğu varsayımı (!) ile dizilimi ortaya konmuş. Ve yayın yazarın, mevzubahis şey bir “virüs”müş gibi, bu intibaı verecek şekilde (halbuki tamamen ispatsız) mutasyonlardan, yeniden kombinasyonlara gitmelerden, genotiplerden, moleküler evolüsyondan, suşlardan ve viroloji jargonu içeren diğer şeylerden bahisle yaptığı spekülasyonlar ile son buluyor.  

**Miyar: İng. Reagent. Bir maddenin varlığını ya da niteliğini belirleme amacıyla çözeltiye ilave edilen madde; miyar; ayıraç

SARS-CoV Koronavirüsü.

Referans yayın: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

Yayında pürifikasyonun sözü edilmiyor. Filtrasyon veya santrifüjlemenin bahsi dahi geçmiyor. Söylenen tek şey virüslerin, iki hastaya ait nazofarengeal aspiratlar ile akciğer biyopsilerinin yavru maymundan alınmış karaciğer hücrelerinde oluşturmuş kültürden izole edilmiş olduğu. Kontrol olarak kullanılan herhangi bir düzenek yine yok. Bir tek bir “sitopatik etki”den [hücre yapısında değişiklik, bozulma] bahsediliyor, o da virüse atfediliyor, varlığı bilinen virüs ve retrovirüslere PCR ile baktık ve bir sonuç elde edemedik deniyor. En sonunda bir RT-PCR’a girişiliyor, bunda da “rasgele seçilmiş inisiyatörler” [başlatıcılar] kullanılıyor ve “kaynağı bilinmeyen” [neye ait olduğu, nereden geldiği belli olmayan] bir gen dizilimi saptanıyor. Bununla ilgili olarak da, “koronavirüs ailesi ile zayıf bir homoloji” [benzeşme] tespit ediliyor. Sonra bu gen dizilimi için primerler hazırlıyorlar ve test etitkleri 44 SARS hastasından yalnız 22’si pozitif çıkıyor.

Koronavirüs NL63. 

Referans yayın: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004. 

Yazarlar şöyle diyor: “Kimliği bilinmeyen patojenlerin neye ait olduğunu moleküler biyoloji gereçleri ile bulmak zor, zira hedef dizilimin ne olduğu bilinmediğinden PCR’ye özel inisiyatörler  de [başlatıcılar] hazırlanamıyor.”

Burada VIDISCA adlı kendi geliştirmiş oldukları ve dizilimin ne olduğunu bilmeye gerek bırakmadığını iddia ettikleri bir gereç kullanmışlar! Böyle bir şey mümkün olabilir mi? Yapılan şey tam olarak nedir, bir bakalım: Önce kültür hazırlanıyor ve görülen “sitopatik etki”ye dayanılarak ortamda virüs olduğuna kanaat getiriliyor. Bu metodun getirdiği yenilik şu; nükleik asit moleküllerini mutlaka aynı uzunlukta olacak şekilde belirli yerlerinden kesen ve ismine “kısıtlama enzimleri” [restriction enzymes] denilen bir tür enzim kullanıyorlar. Bu enzimlere maruz bırakıldıktan sonra ortaya çok sayıda aynı veya oldukça benzeşen DNA veya RNA bölümleri çıkıyorsa, o zaman bu virüsten gelmiştir diyorlar. Burada da, canlı konağın genomu olsa birbirine benzemeyen dizilimde fragmanların ortaya çıkması lazım ama virüs öyle değil, virüs kendini kopyalayarak çoğaldığından birbirinin aynı dizilim parçaları görülüyorsa, bu olsa olsa virüs kaynaklıdır mantığı güdüyorlar. Peki ama bu çıkarım doğru mu? Elbette değil! Bu varsayım (ki ortada bir virüs olduğu varsayımının üzerine yapılmış ikinci varsayımdır bu), “virüs benzeri partiküller”, “retrovirüs benzeri partiküller”, “endojen retrovirüsler”, “eksozomlar”, “vücut hücrelerinin dışında kalan alanlardaki” partiküller ve hatta mitokondriyel DNA mevcudiyetini hiç hesaba katmamakta. “Virüs”lerle aynı kapasitede üreme özelliği gösteren dünya kadar partikül bulunmakta ve bunlar enzimle kesildikten sonra ortaya çıkarmış oldukları birbirinin aynı kopyalarla testte yanıltıcı sonuç çıkmasına neden olabilir. VIDISCA’da kullanılan teknikle ilgili kaleme alınmış “Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery” başlıklı makalede de bahsini ettiğimiz bu açık ele alınmaktadır. Virus Research (Virüs Araştırmaları) dergisinin 2 Nisan 2019 tarihli 263. sayısında Cormac M. Kinsella et al. tarafından kaleme alınmış makalede geçen şu ifadeyle de bu gerçek kabul edilmektedir: “VIDISCA insert’ünde konağın sağladığı arkaplan nükleik asitten fazlası, ‘virüs benzeri’ karakteristikleri olması (yani mitokondriyel DNA’da olduğu gibi fazla sayıda kopya üretebilme yeteneği) haricinde, beklememektedir.”

Koronavirüs HKU1. 

Referans yayın: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005. 

İnanılır gibi değil ama makale şu sözlerle açılıyor: “Solunum yolları enfeksiyonlarından mustarip hastalar üzerinde bugüne kadar yürütülmüş yoğun ve detaylı araştırmalara rağmen, hastaların önemli bir bölümünde mikrobiyolojik bir nedene rastlanmamıştır. RNA, saf hale getirilmemiş kültürlerden çıkarılmaktadır.” Ve burada da koronavirüs genlerinin bulunduğu bir PCR kullanılıyor. Sekanslama (gen diziliminin oluşturulması) için familya, domain, fonksiyonel yerleşkelere göre düzenlenmiş iki protein veritabanı -PFAM and INterProScan- ile birlikte, nükleotidlerin nasıl birleşmesi gerektiği üzerine “tahmin” yürütmede kullanılan iki de bilgisayar programından yararlanılıyor. Yayında şu ifadeler de geçiyor: “Genler tarafımızdan manuel olarak bir araya getirilip sekanlanslanmış olup, ardından da virüs genomuna ait dizilime son halini vermek üzere düzeltme yapılmıştır [editing].” Ve bu çalışmada da herhangi bir kontrol düzeneği görmüyoruz.  

MERS-CoV Coronavirus. 

Referans yayın: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012. 

Genetik materyal, High Puré Viral Nucleic Acid Kit adlı bir gereçle doğrudan kültür üst fazı ve balgam numunesinden ekstrakte edilip ardından da farklı PCR’larla, bilinen türlü mikroorganizmalarla eşleşiyor mu diye bakılıyor. Pürifikasyon yapıldığına dair bir bildirim göremiyoruz yayında ve kontrol düzeneği yine yok

Kısacası, daha ilk koronavirüslerden itibaren (ve “virüs” olduğu öne sürülen diğer diğer pekçoğu için de) yapılmış olan şey şu: Enfekte olduğu varsayılan (her ne “sitopatik etki” gözlemleniyorsa bunun bir tek virüs mevcudiyetine bağlı oluşabileceği varsayılıyor) dokular kültürlenip ya buradan birtakım proteinler elde ediliyor ve hiçbir teste filan tabi tutulmadan “virüs antijenleri” ilan ediliyorlar ve sonra bu “antijenler” olur da doku kültürlerinde de çıkarsa [burada tespit edilirse] bunu da “izolasyon”dan sayıyorlar veyahut da, virüse ait olduğu önkabulüyle kültürden birtakım nükleik asit fragmanları çıkarılıyor [ekstraksiyon].    

Bir önceki sayıda yer verdiğimiz makaleden hatırlayacağınız gibi, Dr. Stefan Lanka’ya göre bu “sitopatik etki” denilen şey esasında bizzat kültürün içine sokulduğu koşullardan kaynaklanmakta. Bu durum, Andrea Németh ve arkadaşlarının 15 Ağustos 2017 tarihinde Nature dergisinde yayına giren Antibiyotik uygulamasına bağlı olarak açığa çıkan, yüzeyle ilintili DNA’ya sahip küçük ekstraselüler [hücredışı] veziküller (eksozomlar) başlıklı yayınlarında da tanımlanmış durumda.  

Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf)

Burada açıklandığına göre, laboratuvar deneyi [in-vitro deney] yapılırken hücre kültürüne dışarıdan eklenen bazı maddeler, örneğin antibiyotikler, oluşturduğu stresle daha önce kültürde varlığı saptanmayan yeni birtakım gen dizilimlerinin ortaya çıkmasına neden olabilmekte. Bu durumun, 1983’te Nobel ödülünü kabul konuşmasında bizzat Dr. Barbara McClintock tarafından da dile getirilmiş olduğunu hatırlatalım. 

https://www.nobelprize.org/uploads/2018/06/mcclintocklecture.pdf

İşin özü şu ki, İNSANA AİT KORONAVİRÜS OLARAK ADDEDİLEN YEDİ VİRÜS DE GERÇEKTE İZOLE EDİLMEMİŞTİR. Birbirlerinden tek farkları kullanılan laboratuvar prosedür ve teknikleridir, ki bunlar da gitgide daha sofistike hale gelmiş, ancak bu sofistikasyon daha doğru sonuçlar elde etmek olarak değil, kanma ve kandırmacaya daha müsait bir zemin oluşturma olarak tezahür etmiş, bu durum SARS-CoV-2 diye bir şeyin kağıt üzerinde yoktan var edilmesi, resmen icat edilmesi ile doruk noktasına ulaşmıştır. 

Böyle bir virüs izole filan edilmemişse, buradan çıkacak sonuç bittabii ki bu tür “koronavirüsler”in herhangi bir hastalığın sorumlusu olarak gösterilemeyeceğidir. Dahası, bahsi geçen “virüsler”e ait olduğu öne sürülen yapı ve bölümler (nükleik asitler veya proteinler) üzerinden düzenlenmiş her ne tür test düzeneği olursa olsun hiçbir şekilde ne “enfeksiyon testi” olma vasfına ne de “tanı testi” olma hükmüne sahiptirler.

YANITSIZ KALAN SORULARA YENİLERİ EKLENİYOR 

Önceki sayıda, SARS-CoV-2 “virüs”ünü izole ettiklerinden bahseden bilimsel yayınların yazarlarına yöneltilmiş sorulara gelen yanıtların derlemesini sunmuştuk. Bu yazarlar virüs için “saflaştırma” prosesinin yapılmamış olduğunu kabul ve ikrarla, esasen virüsün izole de edilmemiş olduğunu kabul etmiş oldular. Ve şimdi bu kanıtlara bir yenisini daha ekliyoruz: Farklı ülkelerin resmi yetkililerince (siyasi idare ve sağlık bakanlıkları nezdinde) SARS-CoV-2 izolasyonu ve pürifikasyonuna [saflaştırma] dair sorgulamalara verilmiş yanıtlar.  

James McCumiskey’den –Son Tezgah: Biyomedikal Paradigma (The Latest Conspiracy: The Biomedical Paradigm) kitabının yazarı- öğrendiğimize göre, İrlanda Milli Virüs Referans Laboratuvarı konuyla ilgili Dublin Üniversitesi‘nden bilgi istiyor, üniversite ise “talebe cevaben verebilecekleri bir kaydın bulunmadığı” yanıtını veriyor. Laboratuvarın hukuki hizmetler birimi direktörü ısrarcı olunca üniversitenin yanıtı şu oluyor: “Üniversite olarak, akademik konuların Bilgi Edinme Hakkı Kanunu gereğince sorgulamaya tabi tutulamayacağı görüşündeyiz.” Milli Virüs Referans Laboratuvarı’nın yapmış olduğu bilgi talebinden şunu anlıyoruz ki, üniversite SARS-CoV-2’yi izole etmiş ve buradan kültürlemeye gitmiş değil. Kabul ve ifade ettikleri tek durum, “diagnostik numunelerde SARS-CoV-2 RNA’sı saptanmış” olması.  

22 Haziran’da bir grup uzman benzer bir sorgulamayı doğrudan İngiltere başbakanı Boris Johnson‘a yapmıştı. Mektupta imzası olanlardan Dr. Kevin Corbett (Imperial College’da akademisyen) ve Piers Corbyn (mühendis, bağımsız araştırmacı) ile o dönemde yaptığımız söyleşiyi de yayımlamıştık. Bunun dışındaki imza sahipleri ise David Crowe, Dr. Andrew Kaufman, Edinburgh’da biyoloji profesörü Roger Watson ile kimyager David Rasnick idi. Bu isimler ortak sorgularına hala bir yanıt alabilmiş değiller! 

Benzer bir başka sorgu, bu defa Kanada’nın Milli Araştırmalar Konseyi’ne yapışmış ve aldıkları cevap şu: “MAK’deki kayıtlar bütünüyle incelenememiş olduğundan üzülerek bildirmek istiyoruz ki, talebinize cevap olabilecek yayın bulunamamıştır.

Buna Kanada, Avustralya, Yeni Zelanda, Avustralya, Almanya, Birleşik Krallık ve Amerika Birleşik Devletleri’nde ‘Bilgi Edinme Hakkı Kanunu’ çerçevesinde benzer sorgulamalarda bulunmuş iki gazeteciyi de eklememiz lazım, zira 5 Eylül itibariyle on iki resmi kurum yapılmış başvuruya yanıt vermiş durumda ve hepsi de aynı şeyi söylüyor; ellerinde Covid 19’a yol açmış olması lazım gelen virüsün izolasyonunu tarif eden çalışma kaydı yok. Sorulara verilen resmi yanıtların detayları şuradan görülebilir: https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-ofcovid-19-virus-isolation/ 

DÜZMECE GENOMUN ÇIKIŞ NOKTASI NERESİ

Bu durumda kendimize sorduğumuz soru şu oldu: Tıbbi yayınlarda bahsi edilen gen dizilimleri -iddia edildiği gibi- yeni birtakım virüslere ait değilse, nereden çıkmış olabilirler? Bu sorunun cevabını bulmak için de, verili gen dizilimini Birleşik Devletler’in Milli Sağlık Enstitüleri’nde kayıtlı tüm dizilimlerle kıyaslamamıza olanak verecek bir ‘dizilim sırası arama gereci’ olan Basic Local Alignment Search Tool (BLAST) adlı bir bilgisayar programı kullandık. (ABD’nin milli sağlık enstitüleri kamusal erişime açık olup şuradan sorgulama yapılabiliyor: https://blast.ncbi.nlm.nih.gov/Blast.cgi.)  Neyi nasıl yaptığımızı burada sizlere adım adım anlatacağız ki, okurlarımız da girip aratsın ve sonuçların sağlamasını yapabilsin. 

Önce WHO’nun internet sitesinde o zaman gösterilmekte olan protokollerde tanımlı PCR inisiyatörlerinin [başlatıcılar] hepsini topladık:  

– Çin CDC’sinin protokolü: hedef olarak ORF1ab ve N genlerini kullanıyor.

– Fransa’nın Pastör Enstitüsü’ne (Pasteur Institute) ait protokol: RdRP geninin iki fragmanını kullanıyor (RdRP geninin SARS-CoV-2’ye özel bir gen olduğu iddiası var). 

– Birleşik Devletler CDC’sinin protokolü: N geninden üç fragman (parça, bölüm) kullanıyor. 

– Japonya’nın Milli Enfeksiyon Hastalıklar Enstitüsünün protokolü: Diğer koronavirüsler ile ortak olduğu öne sürülen diğer genlerin yanırısa, hedef olarak S genini kullanan tek protokol bu.  

– Charite Protokolü (Almanya): E, N ve RdRP genlerini kullanıyor. 

Hong Kong Üniversitesi‘nin Protokolü: ORF1b-nsp14 ve N genini kullanıyor.

– Tayland Milli Sağlık Enstitüsü protokolü: N genini kullanıyor.

Ardından BLAST programına primerlerin dizilimlerini (aranan dizilimin başı ve arama yönüne göre de sonunu gösteren sekanstır bu) girdik ve bunları hem mikrop hem de insan genomlarının toplamından oluşan iki veritabanında arattık.

SARS-COV-2’DİR DENİLEN SEKANSLAR HEM İNSAN HEM DE MİKROP GENOMUNDA OLAN SEKANSLAR!

Fransızların protokolündeki inisiyatörlerden örnekle, prosedürün nasıl işlediğinin ayrıntısına girelim. İnternetten BLAST programının sitesine girdikten sonra, mikrobiyel genom veritabanında arama yapmak için Microbes’u seçtik ve sonraki sayfaya geçtik. Sonra, ekrana gelen formda ilgili yere, Fransızların protokolünün düz inisiyatörüne ait dizilimi (ATGAGCTTAGTCCTGTG) girdik. Yakınen benzeşen (“highly similar”) dizilimler seçeneğini işaretledik ve BLAST tuşuna batık. Birkaç saniyede sonuçlar ekrandaydı, ekran görüntüsünü aldık (1 no’lu resim) ve kimliği %100 bilinen mikropların gen dizilimlerinden oluşan ve girdiğimiz hedef dizilim ile %77 ila %100 oranında örtüşen 100 adet mikroba -bilhassa bakteri ve arkeye- ait gen dizilimi çıktı karşımıza.  

Buradan tekrar ana sayfaya geçip, bu defa da İnsan (Human) seçeneğini işaretleyip aynı dizilimi insan genomunda arattık ve birkaç saniyede ekrana gelen sonuçların yine ekran görüntüsünü (2 no’lu resim) aldık. Meğer bu gen diziliminin %66 ila %100 oranları arasında eşleştiği ve bilinirliği %100 olan tam 74 dizilim varmış insan genomunda. 

SARS-CoV-2’ye özeldir denilen bu PCR başlangıç primeri, insan genlerindeki 74 kısımla örtüştüğü yetmiyormuş gibi, mikrop genlerine ait fragmanların da 100’üyle çakışıyor!

Bir de testen yazıldığındaki (bitiş) primeri (CTCCCTTTGTGTGTGT) için aynı işlemi tekrarladığımızda sonuçlar benzer çıktı.

Bunlar oldukça kısa dizilimler (sekans) olduğundan (topu topu yirmi kadar genetik harf yahut nükleotidden oluşuyorlar), bir kez daha arama yapalım ama bu sefer bu iki primerle başlayıp biten hedef sekansa (yani SARS-CoV-2’ye ait olduğu iddia edilen genomun, başta ve sonda bulunan bu iki primer arasında kalan bölümüne) bakalım istedik. Bunu yapabilmek için de haliyle, resmi makamlarca “SARS-CoV-2 genomu” ilan edilmiş dizilime ihtiyacımız var. Biz bu virüsü izole ettik ve sekansladık diye ortaya çıkan binlerce laboratuvar var (ki önceki raporlarda açıkladığımız gibi asılsız iddialardır bunlar), ancak biz Milli Biyoteknoloji Bilişim Merkezi’nin internet sitesini (https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2? report=genbank&to=29903) tercih ettik. Siteye girdiğimizde “hedef dizilim”i bulduk; “genom”un 12,690 ve 12,797 konumları arasında kalan 108 nükleotidlik bir fragmandı bu: ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACAACAACAAAGGGAG

Bu defa da bu dizilimle yukarıda anlattığımız işlem basamaklarını aynen tekrar ettiğimizde sonuç yine şaşırtıcıydı, zira mikrop genlerinden %100 eşleşme gösteren yüz adet dizilim de burada çıktı, yanında da insan genomundan %83 ila %95’lik benzeşme oranı ile dört dizilim bulduk. Bundaki eşleşme sayısı daha az evet, fakat burada önemli olan, SARS-CoV-2 diye servis edilen “hedef dizilim”e ait bölümleri istikrarlı şekilde hem mikroplarda hem de kendi genomumuzda buluyor olmamız.

Hayretler içerisinde, bari bir de bu virüsün en belirgin ve kati genidir denilen ve zarf proteinlerinin üretiminden sorumlu olduğu öne sürülen, yeri 26,245 ve 26,472 konumları arasındaki bölüm olan E genini girip aratalım diye düşündük. Bahsi geçen E geni şu: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA.

Aynı işlemler üzerinden bu geni arattığımızda sonuç daha da şaşırtıcı oldu. Bunca uzun bir dizilim olmasına rağmen kimliği %100 tanımlanabilen 100 adet mikrop sekansı da bununla eşleşti, üstüne de %80 ila %100’lük eşleşme oranıyla insan genomuna ait 10 dizilim bulundu. Rastgele aldığımız bir gen bölümünden yine benzer sonuç aldık, ayrıca bir de SARS-CoV-2 nükleokapsidinin proteinlerine karşılık geliyor dedikleri N genine baktığımızda da yine benzer eşleşmeler gördük.

Son olarak bir de şu hücre içine girmede kilit roldeki yapısal “spike” proteinlerini yapıyor, o bakımdan da SARS-CoV-2’nin en spesifik genidir dedikleri S genini test edelim dedik. Bu, 21,563. ve 25,384. konumlar arasındaki 3821 nükleotidden oluşan çok daha uzun bir dizilim olduğundan iki yerden rastgele seçtiğimi bölümlerini alıp arattık ve arattığımız ilk bölüm (TTGGCAAAATTCAAGACTCACTTTC) bir diğer 100 mikrop geni sekansı ile 93 de insan gen sekansına karşılık geldi, ikinci bölüm (CTTGCTGCTACTAAATGCAGAGTGT) de mikrobiyel gen sekanslarından 100’ü ile isan gen sekanslarının 90’ıyla eşleşti. 

S genini hedef dizilim olarak kullanan tek ülke olduğundan Japon Protokolü’nün inisiyatörleriyle araştırmamızı sonlandıralım istedik ve okuyucunun çoktan tahmin etmiş olacağı üzere bunda da oldukça yakın sonuçlar elde ettik: mikroplara ait gen dizilimlerinden 100’ü ile, aidiyet oranı %94.12 ila %100 arasında değişen, insana ait 93 gen dizilimi ile örtüşme!

SONUÇ 

Tüm bu anlattıklarımızdan çıkarımlanacak sonuç gayet açık: SARS-CoV-2 TESPİTİ YAPMADA KULLANILACAK GEÇERLİ TEST YOK DÜNYADA; ne antikor veya antijen testi ne de RT-PCR. S1 diye geçen spike proteinini kodladığı iddia edilen gen üzerinden çalışanları da dahil ettik. Yani bu tam olarak şu demek: TÜM BU “VAKA”, “ENFEKTE İNSAN”, “HASTA”, “ASEMPTOMATİK” YAHUT “COVID-19 ÖLÜMÜ” SAYI VE İSTATİSTİKLERİNİN HİÇBİR BİLİMSEL TEMELİ YOK VE TÜM “POZİTİFLER” DE HATALI POZİTİF. Bu bilginin insanlara bir an evvel verilmesi, sorumluların da kanun önünde hesap vermesi lazım. 

Bu bölümü kapatırken, WHO’nun bile bu testlere itimadının olmadığını eklemek istiyoruz. Bunun için 11 Eylül’de SARS-CoV-2 laboratuvar kılavuzu olarak yayımladıkları belgeye bakmak kafi (Diagnostic tests for SARS-CoV-2https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve). Sayfa 5’te aynen şu söyleniyor: “Şüpheli aktif enfeksiyon vakaları mümkün mertebe RT-PCR gibi bir nükleik asit amplifikasyon testi (NAAT) ile test edilmelidir. NAAT testlerindeki hedef gen SARS-CoV-2 genomundan olmalıdır, lakin şu anda dünyada SARS-CoV-1 dolaşımı sözkonusu olmadığından, hedef olarak bir Sarbekovirüs dizilimi de (aralarında SARS-CoV-1 ve SARS-CoV-2 de olmak üzere insan ve hayvan koronavirüslerinden en az beşini ihtiva ettiği düşünülen virüs dizilimi) kullanılabilir.” Yani WHO, SARS-CoV-2 tetkiki için non-spesifik dizilim kullanımını onaylıyor. 

Sırf bu da değil, kılavuzda daha sonra deniyor ki, “Optimal teşhis, SARS-CoV-2 için genomdan bağımsız en az iki hedefin tanımlı olduğu bir NAAT testi ile yapılmalı, ancak hastalık bulaşının yaygın olduğu yerlerde teşhis için basit bir ‘tek hedefli’ algoritma da kullanılabilir.”

WHO kılavuzunda göre , “Bir veya iki negatif sonuç alınmış olması SARS-CoV-2 enfeksiyonu olmadığı anlamına gelmez. Enfekte bir bireyde sonucun negatif çıkmasına neden olabilecek çok sayıda faktör vardır, bunlar arasında örneğin alınan numunenin düşük kalitede olması, geç aşamada alınmış olması, düzgün muhafaza edilmemesi yahut testle ilgili virüsün mutasyona uğraması veya PCR inhibasyonu gibi teknik nedenler sayılabilir.”

Soruyoruz. Bu ülkenin hakimleri savcıları harekete geçmek için ne bekliyor?

Jesus Garcia Blanca 

Not: Yazar, bilimsel makale taraması ve BLAST programı ile girişilen ziyadesiyle ayrıntılı ve emek isteyen çalışmalardaki sabrı ve yardımları için Juan Pedro Aparicio Alcaraz’a teşekkür eder.

Raporun yayımlandığı adres: https://www.dsalud.com/revistas/numero-242-noviembre-2020/

Okumaya Devam Et

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını göstermiştir.) Sormamız gereken önemli bir soru var:Modern...

Portekiz Mahkemesine göre PCR Testleri Bilimsel Güvenilirlikten Yoksun, Buna Dayanılarak Yapılan Karantina Uygulaması Hukuken Geçersiz

Portekiz Mahkemesine göre PCR Testleri Bilimsel Güvenilirlikten Yoksun, Buna Dayanılarak Yapılan Karantina Uygulaması Hukuken Geçersiz

Portekiz’de görülen bir davada mahkemenin aldığı karar bildirgesinde, PCR testi sonuçlarına çeşitli nedenlerle güvenilemeyeceği ve sırf PCR testi sonucuna dayanılarak insanların karantina gerekçesiyle dolaşım özgürlüklerinin engellenemeyeceği ifade edildi.

Yapılan açıklamada Jaafar ve ark.’nın 2020 yılına ait bilimsel çalışmalarına atıfta bulunularak, testin çıkaracağı sonucun cihazın çalıştırıldığı devir sayısına ve numunedeki viral yüke bağlı olarak değişeceği vurgulanarak, buradan hareketle şunlar söyleniyor: 

“Kişiye uygulanan PCR testi 35 devir ve üstünde çalıştırıldığında pozitif sonuç vermişse, bahsi geçen kişinin enfekte olma ihtimali %3’ün altında, bu sonucun hatalı pozitif olma olasılığı ise %97’dir.”

Mahkeme ayrıca, Portekiz’de yapılmakta olan PCR testlerindeki devir sayısının bilinmediğini de ifade ediyor.

Türkiye’de kullanımda olan PCR testlerinin marka, hazırlanma tarihi, üretildiği ülke, yapılan devir sayısı ve testlerde hangi gen dizilimlerinin kullanıldığı yönünde kamuoyuna yapılmış bir bilgilendirme bulunmamaktadır.

Davaya konu olan karantina uygulaması, ülkeye turist olarak gelen dört kişiden birinde PCR testinin pozitif çıkması üzerinde, bölge sağlık müdürlüğünce kişilerin otelde alıkonulması şeklinde cereyan ediyor. 

Mahkemenin, Bölge Sağlık Müdürlüğü’nün aldığı sağlık tedbiri kararını bozma gerekçesi ise şöyle:

“PCR testlerinin güvenilirliği ile ilgili bilirkişilerce dillendirilen bunca soru işareti ve yanı sıra, testin analiitik parametlereleri ile ilgili bunca bilinmezlik varken, kişide herhangi bir enfeksiyon veya risk olduğuna dair doktor görüşü veya teşhisi de bulunmadığından, mahkemenin sayın C’nin gerçekten Sars-CoV-2 virüsü taşıyıcısı, A, B ve D’nin de temastan dolayı yüksek risk kategorisinde olup olup olmadığını belirleme imkanı bulunmamaktadır.”

Bu noktada PCR’ın icat edilme nedeni ve asıl işlevinin, genetik materyal kopyalamak ve çoğaltmak olduğu unutulmamalıdır. Bu cihaz tıbbi tanı ve tetkik amacıyla kullanıma uygun değildir.

Okumaya Devam Et

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını göstermiştir.) Sormamız gereken önemli bir soru var:Modern...

PCR Test Sonuçları %100 Güvenilmezdir

PCR Test Sonuçları %100 Güvenilmezdir


“Sürüntü testleri %100 güvenilmezdir çünkü ortada izole edilmiş bir virüs yok,” diyor Prof.Dr. Stefano Scoglio 12 Eylül 2020 tarihli bir söyleşisinde. Kasım 2020 itibariyle de İtalya’da 30 farklı yerel mahkemede PCR testi sonuçları üzerinden alınan kararlarla uygulamaya konulan pandemi tedbirlerinin hukuksuzluğu savı üzerinden devlete dava açmış bulunuyor.

İşte Scoglio’nun “Uydurma pandemi, yeni bir icat olarak asemptomatikliğin patolojikliği ve Covid 19 testinin geçersizliği” başlıklı çalışması ve sonraki araştırmalarında ortaya koyduğu gerçekler:

  1. SARS-CoV2 virüsü izole edilmemiş olduğundan, PCR testi sonuçlarının doğruluk oranını saptamak için kullanılabilecek bir altın standart da yoktur. O yüzden bu testlerle elde edilecek sonuçlar tümüyle geçersizdir.

    VİRÜS İZOLASYONU OLDUĞUNU KABUL ETSEK BİLE; 

  2. Kullanımda 100’ün üzerinde sürüntü test kiti var ve bunların tekinin bile resmi verifikasyon ve validasyonu yok. 
  3. Cihazların %99’unda hangi gen dizilimlerinin bulunduğu bilinmiyor.
  4. Almanya’dan Prof. Drosten’ın araştırma ekibi, kullanımda başı çeken test kitinde Çin laboratuvarlarından kendilerine gönderilmiş ve bilgisayarda bir araya getirilmiş gen dizilimi olduğunu kabul etmiş bulunuyor. 
  5. Virüs izole edilmiş varsayılsa bile sistem doğru sonuç almaya değil, pozitif sayısını artırmaya yönelik kurulmuş bir sistem.  
  6. 2020’nin Nisan ayına kadar PCR testlerinde her 3 gen de (E geni, N geni ve RdRp2 geni) aranmakta, kişiden alınan numunede bu 3 gen de bulunduğu takdirde pozitiftir denmekteydi. Kişide enfeksiyon kabiliyetine sahip, bütünlüğü bozulmamış tam bir virüs var diyebilmek için bu 3 genin birden mevcudiyeti aranmakta, bu da pozitiflerde suni yükselmelerin önüne geçmekteydi.

    İtalya’da Sağlık Bakanlığı’nın yayımladığı 2 Nisan tarihli bir genelgeyle getirilen yeni düzenlemeyle, SARS-CoV2’ye ait olduğu ileri sürülen hedef genlerden yalnız birinin mevcudiyeti pozitiflik için yeterli kabul edilmeye başlandı. İlk baştaki yöntemle ilerlenmiş olsa, bugünkü asemptomatik pozitif yığınlarının oluşması söz konusu olamazdı.

Sağlık Bakanlığı, virüs dolaşımının en yoğun seyrettiği kırmızı bölgelerde tek gen bulunsa yeter şeklinde mantık yürütüyor. Bilimsel açıdan ise bu tam bir saçmalık, zira virüsün en yoğun görüldüğü yerlerde üç geni birden bulmak çok daha kolay olmalı. 

7. Dünyanın önde gelen uzmanları PCR testlerinden anlamlı bir sonuç alabilmek için, cihaza yaptırılan devir sayısının 20 ila 30 arasında kalması gerektiğini söylüyor. Frankfurt il sağlık idaresinde yapılan açıklama, 25 devrin üstünde gerçekleştirilen PCR test sonuçlarının hükümsüz olduğu yönünde. İtalya’da ise laboratuvarlar 32 devir ve üstünde çalıştırıyor cihazı, hatta 50 devre çıkanlar da var. Bu durumda PCR testlerinden çıkan sonuçların hiçbir bilimsel ehemiyeti kalmamaktadır. 30 devrin üstünde, çıkacak sonuç otomatikman negatif sayılmalıdır. Milan’daki San Raffaele Hastanesi’nde Mikrobiyoloji Anabilim Dalı başkanlığını yürütmek olan. Professor Massimo Clementi’nin de katıldığı üzere, şayet sağduyulu bir biçimde devir sayısı 30, bilemediniz 35’i aştığı noktada sonuç negatif kabul edilse, pandemi hemen yarın bitmiş olurdu.

8. Gen bankası GISAID’de bugüne kadar SARS-CoV2 mutasyonu olduğu iddiasıyla 150.000 farklı gen dizilimi girilmiş bulunuyor. Virüs bu denli hızlı mutasyona uğruyorsa, 3 ay önce hazırlanmış PCR testi ile bugün dolaşımdaki virüsü aramak mantık dışıdır. Virüsün her ülkeye ve coğrafyaya göre değişiklik gösterdiği iddia edildiğinden, menşei farklı bir ülke olan test kitlerinin yine herhangi bir geçerliliği olmayacaktır.

“1 devir olmuş 10 olmuş 40 olmuş, hiç mühim değil. PCR testinde devir sayısının da hiçbir anlamı yok, zira ortada virüsün mevcudiyetine dair kanıt yok!” – Prof. Dr. Stefano Scoglio 

 

Okumaya Devam Et

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını göstermiştir.) Sormamız gereken önemli bir soru var:Modern...

İtalya’da Açılan Dava : Geçersiz PCR Testleri

İtalya’da Açılan Dava : Geçersiz PCR Testleri

Prof.Dr. Stefano Scoglio
Prof.Dr. Stefano Scoglio

Kök hücre çalışmalarıyla tanınan ve 2018 yılında Nobel Tıp Ödülü’ne aday gösterilen Prof. Dr. Setfano Scoglio, araştırmaları sonucu COVID-19 olarak bilinen hastalık tablosuna yol açtığı iddia edilen SARS-CoV-2 isimli virüsün ne bugüne kadar izole edilerek tanımının ve ispatının yapılmış olduğunu, dolayısıyla bu virüse atfedilen gen dizilimlerinin kaynağı belli olmadığından doğruluklarının sorgulanması gerektiğini; ne de acil durum için kullanımına hükümetlerce onay verilmiş, ancak esasen sadece laboratuvar araştırmalarında kullanımı onaylı PCR test cihazlarının validasyonu bulunduğu ve teşhis amaçlı kullanılamayacak bu cihazların kalibrasyon ve kullanımı ile ilgili oldukça sorunlu yönler bulunduğu gerekçesiyle, İtalyan mahkemelerinde devlete karşı dava açtıklarını bildirmekte.

Mahkemeye sundukları iddianamenin İngilizceye tercümesinden sizler için aktarıyoruz:

COVID-19 için geliştirilmiş sürüntü testleri hakkında açılan dava konusu:

İmza sahipleri:

1) Enfeksiyon Hastalıkları ve Viroloji uzmanı, Dr. Fabio Franchi, Nanopatolojiler üzerine uzman Dr. Antonietta Gatti, eczacı ve nanopatoloji uzmanı Stefano Montanari ve 2018 Nobel Tıp Ödülü adaylarından bilimadamı Prof. Stefano Scoglio’nun ortak açıklaması:

Sürüntü testlerinin verdiği sonuçlar hiçbir şekilde güvenilir değildir ve buradan elde edilecek verilerin olağanüstü hal uygulamalarının devamı, bireysel ve toplu karantina uygulamaları, bireysel özgürlüklere getirilen kısıtlamalar ve hayatı kilit altına alma kararları, okullardan işyerlerine ve hatta aile içi ilişkilere kadar vardırılan müdahale ve kısıtlamalara gerekçe olarak kullanılmasının kesinlikle hiçbir bilimsel temeli bulunmamaktadır.”

2) Prof. Stefano Scoglio’nun önderliğinde, COVID 19 sürüntü testleri üzerine yapılmış en kapsamlı çalışma: “COVID-19 sürüntü testleri %95 hatalı pozitif vermekte: İtalyan Milli Sağlık Enstitüsü tarafından onaylı bilgi.”

3) Yukarıda bahsi geçen uzmanların özellikle vurguladıkları noktalar:

a) Avrupa Komisyonu ve İtalyan Milli Sağlık Enstitüsü’nden elde edilen belgelere göre, Avrupa’da 16 Mayıs 2020 itibariyle kullanımda olan 78 çeşit sürüntü testi var; hepsi ruhsatsız, herhangi bir değerlendirme veya validasyona da tabi tutulmamışlar.

b) Aynı dokümanlardan elde edilen bilgiye göre, bu sürüntü testlerinin birçoğunda, taşıdıkları gen dizilimleri (sekansları) deklare edilmiş / açıklanmış değil.

c) Amerikan CDC’sinin ve AB Komisyonu Covid Çalışma grubunun bildirimlerine göre ise Covid-19’a yol açtığı öne sürülmekte olan SARS-Cov2 virüsü şu ana kadar izolasyonu gerçekleştirilerek gösterilmiş veya fiziksel ve kimyasal özellikleri tanımlanmış değildir.

d) Gen dizilimi için model olarak kullanılan patojenik sıvılarda ne bir virüs titrasyonu ne de kuantifikasyonu yapılmış olduğundan, buradan, o sıvılar dahilinde milyarlarca virüs benzeri partikülün (insan organizmasında doğal olarak bulunan ve patojenik özellik taşımayan ekstraselüler veziküller dahil) bulunduğu anlaşılabilir.

Bu da şu ana kadar virüs için ortaya konulmuş spesifik bir marker olmadığı, bu yüzden herhangi bir standardın oluşturulamadığı bu sürüntü testlerinin de güvenilirlikten yoksun olduğu anlamına gelir.

e) Şu an kullanımdaki 100’ü aşkın sürüntü testinin hepsi de, Avrupa Birliği’nin tıbbi cihazların kullanımını düzenleyen 1997 tarihli yasasının yükümlülüklerinden muaf tutulmuştur.

f) Buna ilaveten bu testler, 2017’de taslağı düzenlenmiş ve ancak Mayıs 2020’de yürürlüğe girecek yeni Avrupa standardına da tabi değiller.

g) Yasal düzenlemelerdeki bu boşluk nedeniyle üretici firmalar kontrolsüzce ürünlerini piyasaya sürebilmektedir. Bu da, bu testlerin düzgün çalışmasını garantileyecek standartlara göre imal edilip edilmediklerinin bilinmediği anlamına gelmektedir.

h) Virüsün sürekli mahiyette mutasyona uğradığını gösteren çalışmalar bulunmaktadır. Virüs mutasyon geçirmeye devam ettiği takdirde sürüntü testlerinin işlevini otomatikman yitireceği gerçeği de bizzat sağlık otoritelerince kabul ve ikrar edilmiş durumdadır.

i) GISAID veritabanında SARS-COV-2 virüsü için girilmiş 150.000 farklı dizilim var; Nisan’da bu sayı 70.000’di şu an 150.000 ve gitgide de artıyor bu sayı, zira sürekli yeni mutasyonlar tespit ediliyor, bu da kullanımdaki sürüntü testlerini tamamen geçersiz kılıyor. Ekte, Dr. Scoglio’nun bu elzem konudaki analizi sunulmuştur.

GISAID is a global science initiative and primary source that provides open-access to genomic data of influenza viruses and the novel coronavirus responsible for COVID-19.

Piyasadaki testlerin mevzuata uygun olduğu ve doğru ölçüm yapabildiği kabul edilse dahi, güncel mutasyonları içermediklerinden, çıkardıkları sonucun hiçbir anlamı kalmamaktadır.

j) RT-PCR sürüntü testlerinin metodolojisi ile ilgili de büyük problem bulunmakta. PCR testi konusunda alanın önde gelen uzmanlarınca vurgulandığı üzere, bu metodolojinin düzgün işlemesi, yapılan devir sayısının 20 ila 30 arasında kalmasına bağlı olup, cihazın 35 devri asla aşmaması gerekmektedir. 35 devirlik bu eşik değerin üzerinde, PCR cihazı rastgele sekanslar (gen dizilimleri) yaratmaya başlamaktadır. Ekte sunduğumuz dokümanlardan anlaşılacağı gibi, yürürlükteki testlerin hemen hepsi 35-40 devirlik ortalamanın üstünde çalıştırılmakta olup verdikleri sonuçlar tamamen geçersizdir, hatalı pozitif üretmektedirler.

k) İtalyan Milli Sağlık Enstitüsü’ne ait bir dokümanda yazdığı üzere, sürüntü testlerinin etkinliği 3 faktöre dayanmakta:

  • Hassasiyet: jenerik RNA varlığını tespit edebilme yeteneği
  • Spesifite: Hangi virüs sözkonusu ise bir tek onun RNA’sını ayırt etme, saptama yeteneği
  • Prevalans: Popülasyonda viral hastalığın varlığı, gösterdiği yayılım.

Prevalans ne kadar yüksekse, dolaşımda o kadar çok virüs var demektir, testle bulması da o kadar olası olacaktır. Bugüne değin İtalya’da gözlemlenen prevalans, bu rakam gerçek pandemilerde nüfusun %30’larını bulabilecekken, şu ana kadar bu virüs için %0.1 olarak gerçekleşmiştir. Bu oran 10 kat artsa dahi, hala testin ölçebilirliği bakımından olması gereken alt eşik değerin altında kalmaktadır. Bu konudaki uluslararası otorite olan FIND’ın ISS’den alınan tablosuna göre, İtalya’daki sürüntü testleri ortalama olarak şu an %85 – %90 arası hatalı pozitif vermektedir.

Esas itibariyle, farinjiyal veya nazal COVID-19 sürüntü testlerinin HİÇBİR DİYAGNOSTİK DEĞERİ BULUNMAMAKTADIR.

DEĞERLENDİRMEYE ALINMASI GEREKEN NOKTALAR

A) Son birkaç aydır sözkonusu sürüntü testleri baz alınarak medyadan aşağıdaki konularda ALARM VERİCİ BİRTAKIM VERİLER kamuoyuna servis edilmektedir:

1) Covid ölümlerinin sayısı;
2) Covid tanısıyla hastaneye kaldırılanların sayısı;
3) Covid’le enfekte, ancak asemptomatik olanların sayısı;

B) Bu testlerin sonuçları baz alınarak BİRTAKIM TEDBİR KARARLARI alınmaktadır:

1) Karantina tedabirleri uygulanmak suretiyle kişisel özgürlükler kısıtlanmakta;
2) Ülkenin milli sınırları dahilinde ve bölgeler arasında seyahat ve dolaşım özgürlüğü kısıtlanmakta;
3) Ülke sınırlarından içeri giriş veya bölgeler arası geçişler kısıtlanmakta;
4) Tüm bu tedbirler ülke ekonomisine ağır kayıplar yaşatırken ve halkın sırtına da büyük yük binmektedir.

C) Bu testlere dayanılarak alınan kararlarla yine aşağıdaki alanlarda olumsuzluklar ve hak ihlalleri yaşanmaktadır:

1) eğitim-öğrenim hakkı;
2) halk sağlığı hizmetlerine erişim ve faydalanma hakkı;
3) kreş anaokullarına erişim hakkı;
4) işe gitme ve çalışma hakkı;
5) özel finansal inisiyatifte bulunma özgürlüğü.
Tüm bu sayılanların İtalyan ekonomisine ağır etkileri olmuş, başta küçük ve orta ölçek işletmeler olmak üzere ülkede üretim faaliyetleri düzeltilemez biçimde yara almıştır. İş sahipleri kadar çalışanlar da doğrudan veya dolaylı olarak olağanüstü maddi ve manevi kayıplara uğramış, ayrıca biyolojik olarak da olumsuz etkilenmiş, tüm popülasyonda özellikle anksiyete ve korku inanılmaz üst seviyelere çıkmıştır.

Yukarıda belirtilen faktörler ve gerçekler ışığında, aşağıda ismi geçen tarafların talepleri şunlardır:
Mahkeme, sunulan kanıtlar incelenmek suretiyle gerekli soruşturmayı yürüterek, kriminal ve kanuna aykırı yapılmış işleri uygulayanlar hakkında işlem yapılması için harekete geçmelidir.

Sorumlular bulunarak bireysel kayıpların tazminini karşılamaları istenmektedir.

Metnin İngilizce versiyonuna ulaşmak için tıklayınız.