Kaynaklarla Corona- “Arkası yarın” yazı dizisi-2

Kaynaklarla Corona- “Arkası yarın” yazı dizisi-2

Bir önceki yazımda size araştırdığım, etkilendiğim, bilgilendiğim kaynakları paylaşacağımdan bahsetmiştim.

Sözlerine, araştırmalarına, çalışmalarına itibar ettiğim, mart ayından beri dünyada ana akım medyada yer bulamayan, ama çok izlenen, takip edilen kişileri kısaca sıralayacağım. Amacım verdiğim linklerle de, onlar ne söyleşmişler, ne gibi çalışmalar yapmışlar, nasıl biraraya gelip ortak ses olmaya çalışmışlar; işte bunları ortaya koymak.

Bu kişilerin fotoğraflarının da bu blogda yer almasına önem veriyorum. Çünkü fotoğraflar, görseller çok daha kolay hafızaya kazınıyor, hele hele tabii tekrarlanınca.

.

Önce şunu söyleyeyim, Almanca diline iyi hakim olduğumdan, uzun yıllar Avusturya ve Almanya’da yaşadığımdan, ve oralardaki gelişmeleri sürekli takip ettiğimden, biri 21, diğeri 31 yaşında olan kızlarım Alman eğitim sisteminin içinde yetiştiklerinden şimdiye kadar araştırmalarımı hep Almanca yaptım. Kısa bir süre öncesine kadar Avusturya vatandaşıydım ayrıca.

14 yıl Viyana’da yaşadım. Büyük kızım orada doğdu. 2005in aralık ayında kanserden ölen eşim Süha Şenol ile orada evlendik. Daha sonra Halle/Almanya’da yaşadık bir süre. 1998 den beri tekrar İstanbul’dayım. Farklı kültürleri,yapıları, politikaları tanıdım süreç içinde.

“Die Würde des Menschen ist unanstastbar= insanın onuru zedelenemez” Alman Anayasasının birinci maddesi, ve ben bunu hep çok önemsedim, ve konuyu hukuki, psikolojik ve sosyal boyutuyla ele almaya, irdelemeye, deşmeye çalışıyorum. Deşdikçe de, bundan bir- iki yıl önceye kadar edinmiş olduğum bilgilerde ne gibi eksikler olduğunu görüyorum.

31 ocak 2021, yani dün, Viyana’da Corona tedbirlerine karşı bir protesto vardı. İzin verilmedi protestoya. Ama yine de çok sayıda katılımcı ile protesto gerçekleşti. Polis toplananları dağıtmak istedi, fakat daha sonra bir ara polisin kasklarını indirip onlarla beraber yürüdüğünü gördük. Canlı yayından artık bunları görmek mümkün. Ana akım medyada ise Avrupa’da mayıs ayından beri süren protestolar yer bulmuyor, “protestocular için aşırı sağcılar, Naziler, komplo teorisyenleri, Covidiotlar, aşırı solcular, Reichsbürger, Aluhuttraeger, aşı karşıtları”gibi etiketlemelerle insanların Anayasal hak ve özgürlüklerine sahip çıkmaları hafife alınıyor baştan beri. (Araya karışan radikal gruplar olabilir tabii, ama bu her zaman olabilecek bir durumdur)

Viyana’da dün konuşma yapacağının duyurusu yapılmıştı çok önemsediğim Prof. Dr.Sucharit Bhakdi’nin (protesto yürüyüşüne birgün önce yasak getirilmiş, o yüzden Bhakdi de konuşma yapamamış olabilir, henüz bakamadım)

Benim bir dönem Avusturya vatandaşı olduğumdan dolayı pek de mutlu olduğum gibi, Tayland kökenli, 56 yıldır Almanya’da yaşamasına rağmen 3 sene önce Alman vatandaşı olan çok önemli bir bilim insanı Prof. Bhakdi. Mart 2020 den beri takip ettiğim, internette onlarca konuşmasını dinlediğim ,Mainz üniversitesinde çoğu virolog olan binlerce tıp öğrencisine eğitim vermiş mikrobiyolog, enfeksiyon epidemiyoloğu Prof. Dr. Sucharit Bhadi Almanya’dan ayrılmaya karar vermiş. Almanya’da demokrasinin işlemediğini, ifade özgürlüğünün kalmadığını, buna seyirci kalamayacağını söylüyor. (buna bilim özgürlüğü demek daha iyi olur, çünkü gerçek bilime, tecrübelere ve kanıta dayalı bilime değer vermiyor politikacılar ve medya)

Almanya’da 18 kasımda enfeksiyon koruma yasasındaki değiişiklik parlamentoda onay alınca, hükümet artık tek başına yetkili, ve Olağanüstü hali uzatmada da ve örneğin aşı gibi birçok başka konuda.

Almanya’daki Corona ile ilgili daha doğrusu hastalıklar ile ilgili nasıl bir sistem olduğunu söyleyeyim önce. Merkel hükümeti, Robert Koch enstitüsünün, Charite Berlin’den başvirolog, başdanışman Prof. Christian Drosten, Leopoldina-Ulusal Bilim Akademisinin danışmanlığında, onların tavsiyelerine dayanarak tedbirler, önlemler ile ilgili karar veriliyor. Ve medyada, hükümetin basın toplantılarında da onlar yer alıyor. Sağlık bakanı Jens Spahn (eğitimi sağlık üzerine değil, bankacılık üzerinedir) , Robert Koch enstitüsü(RKI) zaten hükümete bağlı, ABD nin CDC si (centers for disease for control and prevention, Hastalık kontrol ve koruma merkezi) RKI yıllardır hastalıklarla, virüslerle hastanelerden, doktorlardan detaylı veriler de orada toplanıyor, raporlar yayınlanıyor). Paul Ehrlich enstitüsünün, STIKO’nun ise aşılar, ilaçlarla ilgili büyük sorumluluğu var. (STIKO Aşılama Daimi Komitesi, Almanya’nın Berlin kentindeki Robert Koch Enstitüsü’nde, bağımsız Alman devletleri tarafından kullanılan aşılama programları için resmi öneriler sağlayan 18 üyeden oluşan bilimsel bir komitedir).

Benim dikkatimi çeken ise her yıl binlerce grip ölümünün gerçekleştiği grip sezonunda (2017-2018 25.000 ölü), covid-19 un gündeme oturduğu 2019/2020 yılında sadece 411 gripten ölüm vakası var RKI ye göre. Oysa çoğu influenza olduğu düşünülen grip sezonu ekim-mart ayları arasında, corona virüsleri ise kasım ortası ile nisan arasında. Grip aşıları da bir yıl önceki ve/veya erken en ağır vakaların yaşandığı kış grip sezonuna göre grip hasta ve ölümlerinin olduğu güney yarımküredeki ülkelerdeki verilere göre influenza virüslerine göre hazırlanıyor.

Almanya’da R- Wert dediğimiz bulaştırma değeri tüm kapanmaların, sert tedbirlerin alındığı dönemde 1 e 1 e düşüyor, yani bir kişi bir kişiye bulaştırıyor, yani tedbirler alınmadan bulaşı düşüyor ve oran küçük oynamalarla sabit kalıyor. RKI’nin web sitesinde de bu oranları günü gününe takip edebilirsiniz. Ayrıca: https://www.sulesenol.com/post/corona-influenza-vakalar-say%C4%B1lar

Nasıl oluyor da , esas influenza gripleri bitmeye yakınken ama yine gribal semptomlara yol açan Corona virüslerinin azalmasına/bitmesine 1-1,5 ay kala her yıl binlerce grip ölümü gerçekleşen Almanya’da sadece 411 grip ölüm vakası görülüyor?

Diyelim lock-down, maske, mesafe, hijyen tedbirleri işe yaradı da, covid-19 ile mücadele ederken, influenza vakaları da bitti, ama ekim 2019 dan beri gripten ölümler niye bu kadar azdı? Bu yıl niye influenza vakaları, ölümleri göremiyoruz?

Semptomu olup da, PCR pozitif çıkanlarda, başka virüs, bakteri aranıyor mu? İnfluenza virüsleri nerede? Corona virüsleri geçmiş yıllarda arandı mı?

Ya da semptomu olmayan kişilere eskiden test yapılıyor muydu örneğin influenza testi? Hatta semptomları olan kaç kişiye influenza testi yapılmasına gerek gördü doktorlar?

Tüm tıp eğitiminde önce muayene, hastayı dinleme, sonra gerekirse tahliller yapılması öğrenilmedi mi. Ve doktorun tedavi tavsiyesi, reçete yazması, ama hastanın tedavi konusunda kendi karar vermesi gerekmez mi?

PCR testleri teşhis için kullanılabilir mi?

Semptomu olmayanların hastalığı bulaştırdığı varsayımı neye dayanıyor?

Sayıları sürekli artan PCR testleri ile vakalar tespit edilerek, oluşturulan pandemide 2020 yılı Alman cumhurbaşkanı tarafından bilim liyakat nişanı da alan virolog Prof. Drosten’ın aldığı rolü, sustuğu, söylemediği, söyledikleri ile yanılttığı bilgileri de bir dahaki yazımda ele alacağım. Corona-ausschuss’dan avukat Dr. Rainer Füllmich bir müvekkili adına açtığı davanın gerekçelerin de açıklayan Prof. Drosten’a gönderilen tercüme ettiğim yazımı da ekleyeceğim.

Ama önceliğim , dediğim gibi, fikirlerine, duruşlarına, çalışmalarına büyük saygı duyduğum, ve çok şey öğrendiğim bilim insanları, düşünürler, yazarlar, gazeteciler.. ve oluşturulan birlikler.

İlk olarak Prof. Sucharit Bhakdi’yi tanıtmak isterim. Birkaç kısa Türkçe link var tabii, ama maalesef bunlar youtube gibi kanallardan kaldırılıyor. İlk türkçe videolardan https://www.bitchute.com/video/XCajxaF4qTm4/rof

Bhakdi, Almanya’da çok defa alternatif medya kanallarına(özgür medya kanalları demek daha doğru) çıktı. Avusturya’da ise Servus TV de de yer aldı. Bhakdi ilk olarak Almanya Başbakanı Angela Merkel’a yazdığı açık mektupla dikkati çekti. Prof. Bhakdi eşi Prof. Dr. Karina Reiss ile birlikte “Corona-Fehlalarm?? = Corona-yanlış alarm” kitabını yazdı, kitabın İngilizcesi de yayınlandı. https://www.youtube.com/watch?v=Pxyc3fTHi0I

Ben sadece bir arkadaşın gönderdiği birkaç sayfasını ve internetten indirdiğim başka sayfaları okudum, ama onlarca söyleşisini, konferansını izledim. Bence en önemlisi de, Macaristan’da doktorların çağrısı ile gittiği konferans, ve Bhakdi konferans sonucunda onların o zamana kadar virüs ve bulaşıcılığı ile ilgili algısının nasıl değiştiğini görmüş. Doktorların doğrudan Prof. Bhakdi gibi deneyimleri, tecrübeleri olanlardan öğrenecekleri çok şey var. Prof. Bhakdi Alman2009 H1N1 Domuz gribi zamanında (Almanya’da 255 kişi ölmüş) Dr. Wolfgang Wodarg ile birlikte hükümetlerin, Dünya sağlık örgütünün tutumunu, aşı politikalarını eleştiren eski SPD milletvekili, akciğer uzmanı, epidemiyolog, Avrupa Komisyonu sağlık komitesi nde ve ayrıca transparency görev yapmış halk sağlığı ve hijyen uzmanı . Zaten pandemi tanımı da 2009 da değiştirilmeseydi, bugün pandemi ilan edilemeyecekti. Pandemi ilan edilmesi için (Bu konu başlı başına detaylı ele alınması gerekir -Trust WHO ve Profiteure der Angst belgesellerinde de , Corona-Auschuss oturumlarında da detaylı ele alınıyor)

Ayrıca yine başka bir mikrobiyolog var ki, o da pandeminin başlangıcında yaptığı araştırmalara dayanarak covid-19un tehlikesinin ağır bir grip sezonundan daha fazla olmadığını belirtmişti. Stanford üniversitesinden Dr. John İoannidis. Dünyada, çalışmalarda en çok atıf yapılan bu bilim insanıymış kendisi , ve özellikle mevcut araştırmaları eleştirel değerlendirmeleri , düzeltmeleri ile ünlüymüş kendisi. Maalesef onun söylediklerini politikacılar değerlendirmedi. (Trump’ın son dönemde ABD de Dr. Scott Atlas onun çalışmalarının değerini ortaya koydu) https://www.youtube.com/watch?v=biC4nHPYtbA

2021 ocak ayında Stanford üniversitesinden mikrobiyolog ( aynı zamanda istatikçi) Prof. John İoannidis’in de içinde bulunduğu bir ekip, geniş kapsamlı bir çalışmada tüm kilitlenmelerin (lockdown) faydasının olmadığını ortaya koyuyor.

https://de.rt.com/international/111745-stanford-studie-belegt-unwirksamkeit-von-lockdown/

Bugün sadece 2 farklı ülkeden ayrı mikrobiyologdan çok kısa bahsettim. Ama onlarca tıp alanındaki bilim insanı, psikolog, filozof, yazar ve Corona-Ausschuss gibi oluşumlar tanıtılmayı bekliyor.

Sırada kimler var…Tabii ki Almanya’dan başta Dr. Wolfgang Wodarg, Prof. Hockertz, Dr. Bodo Schiffmann, Prof. Christian Schubert, Prof. Ulrike Kaemmerer, Prof. Hendrik Streeck, Prof. Klaus Püschel, Dr. Klaus Köhnlein, Dr. Margareta Griesz Brisson gibi isimler var. Ama aynı zamanda bir Türkçe isime de rastlıyoruz hem doktor hem homeopat, hem de beste yapıp şarkı söylüyor, Dr. Perin Dinekli

Avusturya’da: Dr. Raphaell Bonelli, biyolog Clemens Arvay

Düşünür, yazar, filozof: Peter Schreyer, Gunnar Kaiser, tarihçi Dr. Daniele Ganser

Ve en çok bilgi sahibi olduğum Corona Ausschuss (Corona komitesi) ve avukatları, ayrıca yine oturumlarda sıksık bağlanan Prof. Martin Schwab

Robert F. Kennedy’i, Yeni Zelandalı genç doktor Dr. Sam Bailey’i de, Pfizer’in eski başkan yardımcısı Michael Yeadon’u ise takip ediyorum,

Ayrıca tabii Great Barrington Declaration çok önemli. Almanya’da Aerzte für Aufklaerung, Anwaelte für Aufklaerung gibi oluşumlar da var.

ARKASI YARIN a

Sağlıkla, umutla kalın.

Şule Şenol 01.02.2021

Not: Benim değil, televizyona çıkan, sosyal medya hesaplarında binlerce takipcisi olan profesörlerin, bilim kurulunun, TTB nin de yukarıda verdiğim isim ve kurumları, son dönemdeki çalışmaları, tespitleri de bilmeleri halka da hükümete de sağlıklı bilgiler verebilmeleri için önemlidir.

Aşı Değil, Gen Terapisi!

Aşı Değil, Gen Terapisi!

Avukat Reiner Füllmich: “İnsanlar bu bir “aşı” bile değil, genetik deney diyorlar. Siz ne diyorsunuz?”

Prof. Dolores Cahill: 

“Evet, aşı kriterini karşıladığı söylenemez bunun, fakat aşıya bağlı olumsuz etkiler 3 dalga halinde gelecek bence: Birinci grup, aşılamadan sonraki 1 hafta içinde görülen anafilaksi tarzı olumsuz olayları kapsıyor, böyle bir durumda bu aşının ikinci dozunun verilmemesi gerekir. Birçoğunun 2 doz şeklinde uygulanması planlandı çünkü aşıların. Aşıda her ne mRNA kullanılmış olursa olsun, bu insanlar Şubat veya Mart 2021 veya bir sonraki yıl [ikinci doz aşıyla] bunu vücutlarına yeniden aldıklarında, esas olumsuz etkiler işte o zaman yaşanacak, çünkü hayvan deneylerinde görülen de oydu;

etmenle ikinci karşılaşmada hayvanların %20, %50’si veya tamamının öldüğü görülmüştü.

80 yaş üstündekilerden 1. dozda olumsuz etki yaşayacaklar bazı aşılar için %2.5 olarak belirlenmiş, yani her 40 kişide 1’i aşıdan dolayı çalışamaz veya normal hayatına devam edemez hale gelecek demektir.

2. aşılamada bu oran 10 kişide 1’e yükselebilir, fakat 80 veya 75 yaş üstündekilerin bu mRNA ile yeniden karşılaşmada %80’inin yaşam kısıtlayıcı olumsuz etki yaşayacağını yahut öleceğini düşünüyorum.

Diğer yaş grupları için bir şey öngörmek güç ama belki yarısı ağır yan etki yaşayacak.

Çünkü bu gen terapisi veya tıbbi cihazın yaptığı şey vücudunuzda kronik bir otoimmün hastalık yaratmak;

[fıstık alerjisine atıfla] fıstıkları vücuda enjekte etmek gibi düşünün bunu fakat tabii bilmiyorlar da enjekte edilenin ne olduğunu. Sonra gidip bir şeyle [virüs] karşılaştıklarında elbette olumsuz yanıt verecek vücut buna. Bu olumsuz yanıt da önce anafilaksi (yani alerjik tepki) ile başlayacak, ikinci dalgada da anafilaktik tepkiler görülecek ve fakat vücuda aldığın mRNA her neye karşıysa, bununla üçüncü karşılaşmada vücutta artık hafif şiddette otoimmün hastalık başlatmış olacaksın, bağışıklık kazanmakla filan alakası yok olayın.


Vücuda aldığın mRNA, virüs proteini yapmaya yarıyor ve sen genetiğiyle oynanmış bir organizmasın artık.

İmmün sistemin işi bulduğu virüs veya bakteriyi vücuttan atmak, oysa kendi bedenin, bizzatihi hücrelerin imal ediyor bu virüsleri artık ve yine kendi bedenin bu hücrelere savaş açmak zorunda şimdi ve hafif çaplı bir otoimmün hastalığa sahipsin artık. 

Şubat veya Mart gibi bu virüsle yeniden karşılaşman, immün sisteminin virüsten kurtulmak için uyarılmış olması demek. Oysa bakacak ki aynı virüs proteinleri senin hücrelerinde, organlarında cirit atıyor, immün sistemin eli mahkum, kendi organlarına saldırmaya başlayacak. 1 hafta içinde organ yetmezliğine girmen demek bu, zira kendi immün sistemin kendi organlarını öldürmekle meşgul. Bu durumu yaşayan hastalarda önce sepsis baş gösterecek, bir-iki hafta kadar bu tabloda kaldıktan sonra da organ yetmezliğinden ölecekler.   

Yaşlıların durumundaysa, zaten bir veya iki eşlikçi hastalıkları bulunduğundan bu insanlar immün sistemin randımanlı çalışması için gerekli enerjiye de sahip olmayacaklar ve vücutta süregiden tüm işlemlerden bitap düşüp, fizikman tükenecekler. Bedenlerinin her bir hücresi bu mRNA’yı taşıdığından gidişatı durdurmanın pek bir yolu da yok ve kalp, dalak, ciğerler, karaciğer … birbiri ardına iflas edecek bu mücadelede, çünkü vücudunda bu mRNA’nın protein yapmadığı hücren yok! 

İşte o yüzden acilen, özellikle de bakım evlerindeki yaşlılara vurulan aşı viyallerinden her 100 veya 200’ünden 1’ini alıp muhafaza edeceğimiz bir depo oluşturmamız elzem. Rasgele seçilmiş aşı viyallerini tutacak bir biyolojik depo gibi bir şeyimiz olacak ki, insanlar patır patır ölmeye başladığında açıp bakabilelim bu aşıların içinde tam olarak ne varmış. Hatta bunu şimdi yapıyor olmamız lazım, çünkü verilen aşılarda yalnız korona değil, birden fazla mRNA bulunuyor olabilir. Bilmem anlatabildim mi? Aşıdaki mRNA’nın dizilimini çıkarmamız lazım ki, tutup influenza (grip) veya başka doğal virüslerin genetik materyalini de koymuşlarsa aşıya, insanların immün sistemlerini dolaşımdaki diğer doğal virüslere karşı da uyarmış oluyorlar çünkü, bunu anlayabilelim. Hiç vakit kaybetmeden bir kalite kontrol sistemi oluşturulmalı, doktorların rasgele, uyguladıkları her 100 aşıdan 1’ini depoya teslim etmeleri sağlanmalı ki benim gibi birileri gidip forensik inceleme yapabilsin, bu viyallerde ne var ne yok görülebilsin. Yaşlılar ölmeye başladığında bu aşılarda ne kullanıldığını bilebilmemiz lazım çünkü.

Sonuç olarak, kesinlikle tehlikeli bir gen terapisidir bu ve yaşlı insanlara verilmemelidir.”

İngilizcesi:

Reiner Füllmich: “People say it’s not even a vaccination, it’s a genetic experiment. What do you think?”

Prof. Dolores Cahill:  

“Yeah, so it doesn’t really meet the criteria. But I suppose there are 3 waves of adverse events. Right? There is the adverse events which is more or less like anaphylaxis in the first week. The these vaccines shouldn’t be given in second dose. You know? So I know they’ve planned a lot of them as 2 vaccinations. But the real adverse events will happen, whatever the mRNA is in the vaccine, that when the person comes across that, it could be in February-March, 2021 or a year later, that would be when in the animal studies maybe 20%, 50% or all of the animals died. So I’m also saying that people over 80 who get these between the combination of the first adverse events, which is about 2.5 % in some vaccines, (1 in 40 people) adverse events 

where they’re not able to function or work or live life normally, the second vaccination it could be 1 in 10, but for the over 80 year olds, or 75 year olds, I would think that about 80% of them, 

will have life limiting adverse events or die, when they come across the mRNA again, and for others it’s hard to know, it could be half of the people  will be severely, and what it does is, this gene therapy or medical device is actually setting up, an autoimmune disease, chronically, that’s what it’s setting up, so it’s a bit like injecting peanuts, you know, but they don’t know what it is, and you come across sth and then you go into your adverse events. And the adverse events is you start this anaphylaxis first, the first wave, anaphylaxis, allergic reaction, the second wave, but the third reaction when you come across whatever the mRNA is against, you have stimulated your immune system to a low-grade auto-immune disease, not immunity, to yourself, because the mRNA is expressing a viral protein, you make yourself a genetically modified organism, so the immune system is meant to push the viruses out or the bacteria, but you actually see it in your body, in your cells, the autoimmune disease is attacking yourself low-grade, when you come across the virus, say-February-March, that stimulates the immune system to get rid of the virus, but then it suddenly sees that you have viral proteins in your cells and in your organs, your immune system attacks your own organs, you then after a about a week of that go into organ failure, because your immune system is killing your own organs, and those patients will present as sepsis initially for another week or two, and then will die from organ failure.

And while the elderly die, is that when you have one or more comorbidities, the energy that the immune system requires to boost your immune system will make them very tired, and exhausted, and then they just don’t have the capacity if they have underlying conditions for the immune system–well, you know normally, because this mRNA is in every cell of their body, it’s almost unstoppable because each time they destroy let’s say the heart, or the spleen, you know the lungs or the liver, the mRNA is expressing the protein in every cell, so, just as a solution what we urgently need ia a repository like every 1 in a 100, or 1 in 200 vials that are injected especially into the elderly in the care homes, they need to be stored in a bio-repository of the vaccine vials randomly, so that when the people start to die we can actually see what is in this vaccine, or we should be doing it now, so that– I am concerned that maybe there are multiple mRNAs in this vaccine and not just something for the corona. You know? We should be sequencing the mRNA, because if it was influenza as well or other viruses, we would be priming these people to the natural viruses that are circulating. So there needs to urgently be quality control, random, for doctors to be required to give 1 in a 100 to repository, and someone like me could forensically analyse what’s in these vaccine vials, so that when the elderly start dying, we will know, you know, we should be knowing now what’s in them.

So, it’s absolutely a dangerous gene therapy, should not be given to the elderly.”      

Spiral Anten Atlası Cildi ile İnsanın Frekanslarla İmtihanı

Spiral Anten Atlası Cildi ile İnsanın Frekanslarla İmtihanı

İsrailli fizikçiler 2003’ten bu yana insan cildine, yani en büyük organımıza yayılmış sayıları 2 ila 5 milyon arasında değişen ter bezi kanalları üzerine yayın yapıyor. Alanlarında en çok atıf alan çalışmalardan oluyor bunlar. İlgi neden mi büyük? Çünkü konu telekomünikasyon endüstrisi ve askeriyeyi yakından ilgilendiren 5G teknolojisi ile ilgili de ondan.

2008 – Human skin as arrays of helical antennas in the millimeter and submillimeter wave range
Yuri Feldman 1, Alexander Puzenko, Paul Ben Ishai, Andreas Caduff, Aharon J Agranat
https://pubmed.ncbi.nlm.nih.gov/18517913/

2009 – The electromagnetic response of human skin in the millimetre and submillimetre wave range
Yuri Feldman 1, Alexander Puzenko, Paul Ben Ishai, Andreas Caduff, Issak Davidovich, Fadi Sakran, Aharon J Agranat
https://pubmed.ncbi.nlm.nih.gov/19430110/

2011 – The remote sensing of mental stress from the electromagnetic reflection coefficient of human skin in the sub-THz range
Eli Safrai 1, Paul Ben Ishai, Andreas Caduff, Alexander Puzenko, Alexander Polsman, Aharon J Agranat, Yuri Feldman
https://pubmed.ncbi.nlm.nih.gov/22170380/

2014 – Circular polarization induced by the three-dimensional chiral structure of human sweat ducts
Itai Hayut 1, Paul Ben Ishai 1, Aharon J Agranat 1, Yuri Feldman 1
https://pubmed.ncbi.nlm.nih.gov/24827286/

Ta 1948’lerde “The Book of Antennas” diye ders kitaplarında konu anlatımı yapılan en temel anten tipi işe bakın ki bizzat cildimizde çıkıyor, hem de milyonlarcasıyla!

Antenler, boşlukta yayılan elektromanyetik dalgaları toplayarak iletim kanalı içerisinde yayılmayı sağlamak (receiver) ya da boşluğa elektromanyetik dalgalar yaymak (transmitter) amacıyla tasarlanmışlardır. Antenler, verileri yaydıkları dalgalar itibariyle kilometrelerce uzaklara taşıyabilirler. Bir antenin gönderme ve alma özellikleri aynıdır. Buna antenlerin karşılıklılık (reciprocity) özelliği denir. KAYNAK
Ter bezlerimizdeki spiral kanallar

İbrani Üniversitesi’nden fizik profesörü Ben-Ishai’nin dediğine göre, “bu dalga boylarına [5G frekanslarını kastediyor] maruziyette ciltteki bu sarmal yapıdaki kanallar aktif anten tarlasına dönüşüyor”. Yani vücudumuz daha iletken hale gelmiş oluyor.

2014’teki çalışmaları ile, sarmal yapıdaki ter kanallarımızın, yani anten tarlamızın dışarıya dairesel polarize dalgalar yaydığını ve bunun iki yönlü (sağ-sol) olduğunu keşfediyorlar.

Fiziksel eforda nasıl terliyorsak mental ve duygusal stres altındayken de terliyoruz. Yani sempatik sinir sistemimiz devreye giriyor. Ciltteki ter kanallarının sinirlerle bağlantısı önemli, çünkü askeriyenin de kalabalık (örn. gösterici grubu) dağıtmak için kullandığı ve “ölümcül olmayan silah” kategorisinde yer alan milimetrelik dalga boylarındaki ışın tabancalarına maruziyette cildimizin ateşe verilmiş gibi yanması üzerine sıçrayarak ışından kaçma refleksi göstermemizin nedeni de sinirlerle olan bu bağlantı. Yani iddia edildiğinin aksine, dışarıdan maruz kaldığımız bu çok yüksek frekanstaki dalgalar cilt yüzeyinde kalmıyor, fiziksel ve biyolojik olarak bizi etkiliyor. Bunun mekanizmasını da, ciltteki bu “sarmal anten tarlası”nın keşfi ile anlayabilmiş oluyoruz.

İşin ilginç yanı, tıpkı alıcı-verici görevi gören anten gibi bizim bu sarmal ter kanallarımız vasıtasıyla enerji iletimi salt dışarıdan içeriye doğru değil, aynı zamanda içeriden dışarıya doğru da gerçekleşiyor. Vücut iç sıcaklığı yükseldiğinde (diyelim spor yaptık yahut ateşlendik), ısının içten dışa bu sarmal kanallardan geçerken filtrasyonu ve dışarı dairesel salınımlarla verilmesi sözkonusu.

Yani ciltten hem enerji soğuruyor hem de veriyoruz.

Milimetre ve milimetre altı dalga boylarının biyolojik etkileri olduğunun ortaya çıkması, hem de dünya genelinde farklı gruplarca tekrarlı deneylerle bilimsel olarak kanıtlanmış bulunması endüstri tarafından -Prof. Ben-Ishai’nin tabiriyle- hiç ama hiç hoş karşılanmıyor. İmplikasyonlar çok yönlü çünkü; en basidinden akla doğabilecek türlü cilt hastalıkları, kanser ve elbette ağrı sendromları geliyor. Bunun yanısıra, sinir sistemi ile olan etkileşimde dolayı oluşabilecek korku, anksiyete, depresyon gibi duygu durumlarının yanısıra çeşitli nörolojik rahatsızlıklar elbette akla geliyor.

Bu bir askeri teknoloji ve silah olarak kullanılıyor

ABD, Rusya ve Çin’in savunma bakanlıkları uzun yıllardır 5G’nin sahip olduğu elektromanyetik frekans aralığını kalabalık grupların dağıtılmasında silah olarak kullanıyor. Active Denial Systems denilen bu ışın silahları üzerine doğrultulduğu kişilerin cildinde yanma hissi yaratıyor. Görünmez silahla, iz bırakmadan can yakabiliyorsunuz.

İsrailli araştırma grubunun konuyla ilgili 2016’daki çıkarımları şöyle:

  • Halkın subTerahertz frekans aralığındaki milimetrelik dalga boylarına maruziyeti arttıkça en başta bebekler, gebeler, ileri yaş grubundakiler, hastalar ve elektromanyetik dalgalara aşırı hassasiyeti olanlar bundan olumsuz etkilenecektir.
  • Ciltteki ter kanallarını besleyen sempatik sinir sistem sayesinde insanlar duygu durumlarını bu kanallardan dışarı yaydıkları elektromanyetik dalgalarla yansıtmakta ve aynı şekilde dışarıdan gelen elektromanyetik dalgaları da soğurmaktadır.
  • İnsan ter kanallarının bu yeni tarif edilen fizyolojik ve psikolojik fonksiyonları ne nörofizyologlar ne de psikologlar tarafından çalışılmış değildir.
  • Bilgisayar simülasyonları ter bezlerinin subterahertz (milimetrelik) dalgaları ciltte yoğunlaştırdığını göstermektedir. İnsanlar bu dalgaları sıcaklık şeklinde hissedebilmektedir. Bu dalga boylarını kullanan haberleşme teknolojileri (cep telefonları, wi-fi, antenler) yüzünden insanlar ağrı reseptörleri (nosisptör) vasıtasıyla fiziksel olarak acı ve ağrı duyabilirler.
  • 5G WI FI kullanımı daha fazla yaygınlaştığı takdirde şu anda RF (radyofrekans) / mikrodalga frekansları yüzünden görülen sağlık sorunları ve elektriğe aşırı hassasiyet durumu muhtemelen daha da ağırlaşıp yaygınlaşacak ve belki de henüz bilinmeyen nörolojik problemler ve fiziksel olarak duyulan ağrı ile ilgili şikayetler ortaya çıkacaktır.
  • 5G teknolojisi ile sözkonusu sağlık sorunları arasındaki bağlantının bilimsel bakımdan ispatı mümkün olduğundan, halka tazminat yolu da açılmış olacaktır.

Yazımıza aynı ekipten Prof. Yuri Feldman’ın geçtiğimiz sene İsrail’de düzenlenen ‘2020 Uzmanlar Toplantısı: Kablosuz İnternet & Cep Telefonu Radyasyonu ve Kamu Politikaları’ toplantısındaki sunumunu kapattığı cümleler ile son verelim:

“Peki o zaman 5G zararlı mı değil mi? Valla sağlam alıcı görevi gören bir donanımımız var ve merkezi sinir sistemimizin bu etkiye vereceği yanıt hakkında da fikrimiz yok. Ya hep beraber dahi olup çıkacağız ya da zombi.”

Thomas Cowan-Virüsler, bulaşıcılık ve 5g üzerine..

Thomas Cowan-Virüsler, bulaşıcılık ve 5g üzerine..

Ezber bozan bir kitap olan, amazonda satışı yasaklanan Contagion Myth / Bulaş Efsanesi kitabı yazarı Dr.Thomas Cowan’ın aynı kitabının giriş kısmında bahsettiği videosudur. Konuşma 12 Mart 2020’de yapılmıştır.

Harika konuşmasının dökümü şu şekildedir:

En büyük pan.demi olan 1918 İspanyol gr!bi pan.demisinden sonra Steiner’a tüm bunların neyle ilgili olduğu sorulduğunda şöyle cevap verdi;  
V!rüsler, toksik bir hücrenin atıklarıdır sadece. Virüsler, bazı başka proteinlerle birlikte DNA ya da RNA parçalarıdır, hücreden tomurcuklanarak ayrılırlar.. Hücre zehirlendiği zaman oluşurlar. Hiçbir şeyin nedeni değildirler.

Sizi bu konuda düşünmeye teşvik edeceğim ilk yol şöyle olur;

..farz edin ki bir yunus doktorusunuz, kuzey kutup dairesindeki yunuslar üzerinde çok uzun bir süredir çalışıyorsunuz, ve yunuslar da gayet sağlıklılar. Fakat bir gün sizi arayıp   “Fred, kuzey kutup dairesindeki tüm yunuslar ya da yunusların çoğu ölüyor, gelip araştırabilir misin?”   diyorlar. Ve bir soru sorma hakkınız var.   Oylama yapalım. Kaçınız “Genetik yapısını görmek için bir yunus incelemek istiyorum.” derdi? Hiç kimse. Çünkü bu aptalca.   Kaçınız “Şu ve bu yunusda v!rüs var mı diye incelemek istiyorum çünkü tüm yunusların hastalanma nedeni bulaşıcı bir hastalık olabilir.” derdi? Bu arkadaş. Kaçınız -fransızcamı bağışlayın- “Biri bu suya bi halt mı koydu?” derdi Exxon Valdez kazası gibi. Kimse var mı böyle düşünen? Herkes.   Çünkü olan buydu.   Hücreler zehirlendikleri zaman bizim v!rüs olarak adlandırdığımız atıkları/döküntüleri boşaltarak kendilerini temizlemeye çalışırlar. Eğer NHI(Ulusal Sağlık Enstitüleri) başkanının v!rüslerin karmaşıklığı hakkında yaptığı son konuşmalarından birinde geçen, v!rüslerin eksozom olarak adlandırıldığı güncel teoriye bakarsanız, ..bunun v!rüsün ne olduğu ile ilgili mevcut düşünceye kusursuz bir biçimde uyduğunu görürsünüz.   Bununla ilgili dramatik bir örneğim var:   Ben büyürken evimizin hemen dışında sulak bir arazi vardı. Kurbağalarla doluydu ve geceleri beni uyutmazlardı bu yüzden pencereleri bantlardım, ilkbaharda epey şamata yaparlardı. Fakat zamanla kurbağalar tamamen yok oldu. Kaçınız kurbağaların genetik bir hastalığı olduğunu düşünüyor? Kaçınız kurbağaların bir v!rüse yakalandığını düşünüyor? Kaçınız birisinin suya DDT koyduğunu düşünüyor? Olan buydu.   Hastalıklar zehirlenmedir. Bu, a$ıların neden olduğu.. bunu birazdan anlatayım..  

Peki 1918’de ne oldu?

Son 150 yılda, her pan.demide yeryüzünün elektrifikasyonunda önemli bir atılım vardı. 1918’de, 1917’nin sonbaharının sonlarına doğru, dünya genelinde radyo dalgalarının tanıtımı yapıldı.   Ne zaman herhangi bir biyolojik sistemi yeni bir elektromagnetik alana maruz bırakırsanız. ..onu zehirlersiniz, bazılarını öldürürsünüz ve geri kalanı bir nevi (suspended animation) komaya/kriyojenik uykuya geçer. İlginç bir şekilde biraz daha uzun ama daha hasta olarak yaşarlar.   Sonrasında 2. Dünya Savaşı’nda radar ekipmanlarının tüm dünyaya tanıtımıyla yeni pan.demi başlar. İnsanlık, tüm yeryüzünün radar alanlarıyla örtülmesine ilk defa maruz kaldı. 1968’de Hong Kong gr!bi vardı, bu aynı zamanda Van Allen Kuşağı içerisinde ilk defa dünyanın koruyucu bir tabakasının oluşturulduğu vakitti. Van Allen Kuşağı, esasen güneşten, aydan, jüpiterden vb gelen kozmik alanları bütünleştirerek yeryüzündeki canlılara dağıtır. Ve biz Van Allen Kuşağına radyoaktif frekanslar yayan uydular yerleştirdiğimizde, 6 ay içinde yeni bir v!ral pan.demimiz oluyor. Neden v!ral? Çünkü bireyler zehirlenmiş durumdalar, toksin atıyorlar, bunlar v!rüs gibi görünüyor, insanlar bunun bir gr!p salgını olduğunu düşünüyor.   1918’de Bostan Sağlık Departmanı bunun bulaşıcılığını test etmeye karar verdi. Sonrasında ister inanın ister inanmayın, gr!pli yüzlerce hastanın burnundan sümük çekip gr!p olmayan sağlıklı insanlara enjekte ettiler. Ve bir kere bile karşı taraftaki bireyi hasta edemediler. Bunu tekrar tekrar yapmalarına rağmen bulaşmayı gösteremediler. Görünüşe göre İspanyol gr!bi olan atlarla bile yaptılar bunu. Kafalarına torba geçirip at torbaya hapşırdığı zaman torbayı öteki atın kafasına geçirdiler. Ve tek bir at bile hastalanmadı.   Bunu Art.hur First.enberg’in !nvisible Rainbow/Görünmez Gökkuşağı kitabında okuyabilirsiniz. Kendisi yeryüzünün elektrifikasyonundaki tüm aşamaların ve 6 ay içinde dünya genelinde nasıl yeni bir gr!p pan.demisi oluştuğunun kroniğini çıkarmıştır. Normal açıklamaları duyduğunuzda.. Kansas’tan(ABD) Güney Afrikaya 2 haftada nasıl gitti.. ..yani ulaşım at sırtında ve botlarla sağlanmasına rağmen nasıl oldu da tüm dünya semptomları aynı anda gösterdi.. Bunun hiçbir açıklaması yok, sadece “nasıl olduğunu bilmiyoruz” diyorlar. Fakat bazılarınızın cebinde ve bileğinde olan radyo dalgalarını ve diğer frekansları işin içine katarak düşündüğünüzde, Japonya’ya bir sinyal yollayabilirsiniz ve anında varır. Yani aranızda, dünya çapında saniyeler içinde iletişimi sağlayan bir elektromanyetik alan olduğuna inanmayan varsa sadece olaya dikkatini vermiyor demektir. Yeryüzünün elektrifikasyonunda son 6 ayda dramatik ve önemli bir atılım olduğunu belirteyim.   Ve eminim ki çoğunuz bunun ne olduğunu biliyor; be.şG. Şu anda 20bin radyasyon yayan uydu mevcut, tıpkı cebinizdeki ve bileğinizdeki radyasyon yayan ve sürekli kullandığınız cihaz gibi, ki bu sağlığımız için uygun değil.   Bunu söylediğim için üzgünüm fakat, bu sağlığımız için uygun değil.

Okumaya Devam Et

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını göstermiştir.) Sormamız gereken önemli bir soru var:Modern...

Peki Ama Bu İnsanlar Neden Ölüyor?

COVID-19 Resmi Mortalite Verileri Yaşanan Ölümlerin Viral Hastalık Kaynaklı Olamayacağını, Ana Etmenin Tedavi için Kullanılan İlaçlar Olduğunu...

Pandemi Yok, Covid Aşıları Gereksiz ve Tehlikeli

Pandemi Yok, Covid Aşıları Gereksiz ve Tehlikeli

İşin uzmanından görüş almak ister misiniz?

Burada konuşan doktorların büyük çoğunluğu ya işinden oldu ya karalandı ya emekliliğini almaya zorlandı ve istisnasız hepsi sansürlendi.

Tek soru: Neden?

Kritik eşikteyiz.

Bunlar Da İlginizi Çekebilir

Somatoscope

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını...

Son haberler

AŞI ve ANTİKOR BAĞIŞIKLIK ANLAMINA GELMEZ!

Çocuk İmmünoloji-Allerji Uzmanı, Prof.Dr. Alişan YıldıranAllah Teâlâ ARK hocada razı olsun, sayesinde, hem hadiselerden haberimiz oluyor, hem de bizim erişemediğimiz yerlere münasib cevapları, münasib şekilde veriyor (1). Üzücü olan husus şu ki, memleketimizin...

‘Gerçek Bilim’ vs. ‘Kâbus Film’ – 1. Bölüm

İki tıp sisteminin karşılaştırmasını sunuyoruz; biri Pastör’ün mikrop teorisine [monomorfizm/tek biçimci ekol] dayanıyor, diğeri Béchamp’ın hücre teorisine [pleomorfizim/çokbiçimci ekol].Mikrop teorisine göre dışarıda hazır bekleyen mikroplar var ve bunlar insan...

Corona Sürecindeki Hikayelerine Talibiz

Bizimle konu hakkındaki her türlü duygu, düşünce ve yorumunu paylaşarak bu platforma sen de katkı sağlayabilirsin.

Bize Katıl

Yabancı dilden Türkçe’ye çeviri konusunda destek olmak ya da kendi alanın çerçevesinde paylaşımlarımıza katkı sağlamak istersen, bize yazabilirsin.

Bizi takip et

Güncel paylaşımlardan haberdar olmak ister misin?

Tıpta Dolandırıcılık ve Hile: Virüs Nerede?

Tıpta Dolandırıcılık ve Hile: Virüs Nerede?

“1 devir olmuş 10 olmuş 40 olmuş, hiç mühim değil. PCR testinde devir sayısının da bir anlamı yok, zira ortada virüsün mevcudiyetine dair kanıt yok!” – Prof. Dr. Stefano Scoglio 

Evet, bu defa İspanya’dayız ve Amerika Birleşik Devletleri’nden Dr. Andrew Kaufman ile İtalya’dan Prof. Scoglio’nun farklı kulvarlardan gidip aynı sonuca ulaştıkları konuda, bu uzmanların görüş ve açıklamalarını teyit eder nitelikteki bulgularıyla söz Prof. Jesús García Blanca’da.

Hilekarlık Artık İspatlı: PCR, SARS-CoV-2 tespitine yaramıyor

242. Sayı – Kasım 2020

Covid-19’a atfedilen hastalık ve ölümlere yol açtığından şüphelenilen SARS-Cov-2’yi tespit için kullanılan PCR’lardaki gen dizilimleri, bizzat insan genomundaki düzinelerce dizilimle eşleştiği gibi, yüze yakın mikropta da bulunuyor. Ve bunlara primerler, yani taşıdıkları iddia edilen “genom”dan rastgele alınmış geniş bölümler ile “hedef genler” denilen ve bu “yeni koronavirüs”e özel olduğu iddia edilen dizilimler de dahil. Testin hiçbir hükmü yok ve bugüne kadar çıkan “pozitif”lerin mutlaka bilimsel bakımdan geçersiz ilan edilerek testi alanlara durumun iletilmesi, hayatını kaybetmiş olanların da ailelerine bu bildirimin yapılması gerekir. Zira dünyanın PCR konusunda en önde gelen isimlerinden Stephen Bustin bile, uygun koşullarda PCR ile sonucu pozitif çıkmayacak kimsenin olmadığını ifade ediyor!

Mart’tan bu yana sizleri uyarıyoruz: sizde var mı yok mu anlamak için baktığınız virüsün bileşenleri nedir, neye benzemektedir bilmeden, buna özel test filan geliştiremezsiniz. Virüsün bileşenlerinin neye benzediğini de o virüsü bulup, diğer her şeyden ayrı olarak tek başına ortaya koymadan (saflaştırma/izolasyon) bilebilmenizin imkanı yok. Biz de bu süreçte SARS-CoV-2 denilen virüsün kimse tarafından izole edilmemiş olduğuna ve hatta geçtiğimiz haftaki sayımızda açıkladığımız nedenlerden dolayı böyle bir şeyin (virüs izolasyonu) mümkün de olmadığına dair kanıtları biriktirmeye devam ediyoruz. (Lütfen –www.dsalud.com- sitesinden “Patojenik virüs diye bir şey olduğunu ispat edebilir misiniz?” başlıklı yazımızı okuyunuz). 

Bu raporda da RT-PCR testinin, SARS-CoV-2 denilen şeyi değil, insana ait RNA parçacıkları ile çok sayıda mikropça da taşınmakta olan RNA fragmanlarını bulmakta olduğuna dair yeni verileri sunuyoruz. RT-PCR’ın çok sayıda kurum/kuruluş, WHO ya da CDC gibi resmi ve idari birimler ve dünyada otorite olarak kabul edilen Dr. Stephen Bustin gibi uzmanlarca da kabul edilen türlü problemlerine değinmiş, Bustin’in, çıkan sonuçların yorumlanmasında kullanılacak kriter seçimindeki rastgeleliği de, cihaza yaptırılacak devir sayısı seçimini de tamamen saçma olarak nitelendirdiğinden, çünkü bu şekilde kimi test ederseniz edin pozitif çıkma ihtimali doğurduğundan bahsetmiştik. Bu raporla da, var olduğu iddia edilen SARS-CoV-2 virüsü ve WHO’nun RT-PCR kullanımına dair yönerge ve protokolleri üzerine yapılmış özel bir araştırmanın sonuçlarının yanısıra, geri kalan tüm “insan koronavirüsleri” için toplanmış verileri de sizlerle paylaşmak istiyoruz.

İnsan koronavirüsü” olarak kayda geçen virüslerin yedisinin de izolasyonu gerçekleştirilmemiş!

Araştırmalarımız sonucu ortaya çıkan bulgu ise fazlasıyla ciddi: “İnsan koronavirüsü” olarak kayda geçen virüslerin yedisinin de izolasyonu gerçekleştirilmemiş ve bunları tetkik için kullanılan PCR’lerdeki primerlerin gen dizilimlerinin tamamı ile, virüs genomuna ait diye sunulan genetik fragmanların büyük kısmı bizzat insan genomunun farklı yerlerinde bulunan, ayrıca isimlerini vereceğimiz şu bakteri ve arkelerin genomunda da mevcut olan dizilimler çıkmıştır: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis ve daha niceleri. Bizi bu umulmadık sonuca götüren araştırmayı şimdi sizlere adım adım açıklayacağız.

Koronavirüslerinin herhangi bir tanesi izole edilmiş mi?

Nisan ayının birinci yarısında gerçekleştirdiğimiz ilk incelemede SARS-CoV-2’nin izole edilmemiş olduğunu fark edip, izolasyon yaptıklarını öne sürenlerin ise bunu önceki “insan koronavirüsleri”ne ait “izolat”lara dayanarak ileri sürmekte olduklarını görünce, bahsi geçen bu önceki virüs izolatlarına ait literatürü, iddiaların doğruluğunu sınamak için mercek altına almaya karar verdik. İncelediğimiz insan koronavirüsleri şunlar: 229E (1965’te izole edilmiş olduğu öne sürülmekte), OC43 (1967), SARS-CoV (2003), NL63 (2004), HKU1 (2005) ve MERSCoV (2012). Elde ettiğimiz sonuçlar ise şu şekilde:

Koronavirüs 229E. 

Referans yayın: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1: 190-193. January 1, 1966. 

Bu yazarlar, kullanmış oldukları ‘Kompleman Fiksasyonu’* denilen izolasyon metodundan bahsederken başka yayınlara atıfta bulunmuş olduklarından, metodu anlamak için verdikleri atıflardan birine baktık: Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5): 931-938, May 1965. Antijen-antikor reaksiyonundan hareketle bu ikiliden herhangi birini tespite yarayan, ancak tedavülden kalkmış bir prosedür bu. Burada, yeni virüs olarak lanse edilen yapının antijenleri aranıyor, ancak daha önce de açıkladığımız gibi, bunun için denklemde bulunması gereken virüse-özel antikorlar virüsle ilk defa karşılaşılıyorsa zaten ortada yoktur. 

*Kompleman Fiksasyonu: İng. Complement Fixation. Antijen ve antikorun karşılıklı etkileşimi ile komplemanın aktive oluşu ve antijen-antikor kompleksine bağlanışı; kompleman bağlanması; kompleman tespiti

Koronavirüs OC43. 

Referans yayın: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub. 

Bu yayında, kültürlerden alınıp virüs RNA’sıdır diye ortaya konmuş yapının virüsten geldiğini gösterir hiçbir kanıt bulunmamakta. Deneyde kullanılan QIAamp kiti adlı cihaz miyarları**, inhibitörleri ve kirleticileri temizliyor temizlemesine, ancak yapamadığı şey, çıkan RNA’nın nereden geldiğini belirlemek. Ve deneyde kontrol düzeneği de kullanılmamış. Ardından ise PCR ile büyültülüp, virüs genetik bilgisi olduğu varsayımı (!) ile dizilimi ortaya konmuş. Ve yayın yazarın, mevzubahis şey bir “virüs”müş gibi, bu intibaı verecek şekilde (halbuki tamamen ispatsız) mutasyonlardan, yeniden kombinasyonlara gitmelerden, genotiplerden, moleküler evolüsyondan, suşlardan ve viroloji jargonu içeren diğer şeylerden bahisle yaptığı spekülasyonlar ile son buluyor.  

**Miyar: İng. Reagent. Bir maddenin varlığını ya da niteliğini belirleme amacıyla çözeltiye ilave edilen madde; miyar; ayıraç

SARS-CoV Koronavirüsü.

Referans yayın: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

Yayında pürifikasyonun sözü edilmiyor. Filtrasyon veya santrifüjlemenin bahsi dahi geçmiyor. Söylenen tek şey virüslerin, iki hastaya ait nazofarengeal aspiratlar ile akciğer biyopsilerinin yavru maymundan alınmış karaciğer hücrelerinde oluşturmuş kültürden izole edilmiş olduğu. Kontrol olarak kullanılan herhangi bir düzenek yine yok. Bir tek bir “sitopatik etki”den [hücre yapısında değişiklik, bozulma] bahsediliyor, o da virüse atfediliyor, varlığı bilinen virüs ve retrovirüslere PCR ile baktık ve bir sonuç elde edemedik deniyor. En sonunda bir RT-PCR’a girişiliyor, bunda da “rasgele seçilmiş inisiyatörler” [başlatıcılar] kullanılıyor ve “kaynağı bilinmeyen” [neye ait olduğu, nereden geldiği belli olmayan] bir gen dizilimi saptanıyor. Bununla ilgili olarak da, “koronavirüs ailesi ile zayıf bir homoloji” [benzeşme] tespit ediliyor. Sonra bu gen dizilimi için primerler hazırlıyorlar ve test etitkleri 44 SARS hastasından yalnız 22’si pozitif çıkıyor.

Koronavirüs NL63. 

Referans yayın: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004. 

Yazarlar şöyle diyor: “Kimliği bilinmeyen patojenlerin neye ait olduğunu moleküler biyoloji gereçleri ile bulmak zor, zira hedef dizilimin ne olduğu bilinmediğinden PCR’ye özel inisiyatörler  de [başlatıcılar] hazırlanamıyor.”

Burada VIDISCA adlı kendi geliştirmiş oldukları ve dizilimin ne olduğunu bilmeye gerek bırakmadığını iddia ettikleri bir gereç kullanmışlar! Böyle bir şey mümkün olabilir mi? Yapılan şey tam olarak nedir, bir bakalım: Önce kültür hazırlanıyor ve görülen “sitopatik etki”ye dayanılarak ortamda virüs olduğuna kanaat getiriliyor. Bu metodun getirdiği yenilik şu; nükleik asit moleküllerini mutlaka aynı uzunlukta olacak şekilde belirli yerlerinden kesen ve ismine “kısıtlama enzimleri” [restriction enzymes] denilen bir tür enzim kullanıyorlar. Bu enzimlere maruz bırakıldıktan sonra ortaya çok sayıda aynı veya oldukça benzeşen DNA veya RNA bölümleri çıkıyorsa, o zaman bu virüsten gelmiştir diyorlar. Burada da, canlı konağın genomu olsa birbirine benzemeyen dizilimde fragmanların ortaya çıkması lazım ama virüs öyle değil, virüs kendini kopyalayarak çoğaldığından birbirinin aynı dizilim parçaları görülüyorsa, bu olsa olsa virüs kaynaklıdır mantığı güdüyorlar. Peki ama bu çıkarım doğru mu? Elbette değil! Bu varsayım (ki ortada bir virüs olduğu varsayımının üzerine yapılmış ikinci varsayımdır bu), “virüs benzeri partiküller”, “retrovirüs benzeri partiküller”, “endojen retrovirüsler”, “eksozomlar”, “vücut hücrelerinin dışında kalan alanlardaki” partiküller ve hatta mitokondriyel DNA mevcudiyetini hiç hesaba katmamakta. “Virüs”lerle aynı kapasitede üreme özelliği gösteren dünya kadar partikül bulunmakta ve bunlar enzimle kesildikten sonra ortaya çıkarmış oldukları birbirinin aynı kopyalarla testte yanıltıcı sonuç çıkmasına neden olabilir. VIDISCA’da kullanılan teknikle ilgili kaleme alınmış “Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery” başlıklı makalede de bahsini ettiğimiz bu açık ele alınmaktadır. Virus Research (Virüs Araştırmaları) dergisinin 2 Nisan 2019 tarihli 263. sayısında Cormac M. Kinsella et al. tarafından kaleme alınmış makalede geçen şu ifadeyle de bu gerçek kabul edilmektedir: “VIDISCA insert’ünde konağın sağladığı arkaplan nükleik asitten fazlası, ‘virüs benzeri’ karakteristikleri olması (yani mitokondriyel DNA’da olduğu gibi fazla sayıda kopya üretebilme yeteneği) haricinde, beklememektedir.”

Koronavirüs HKU1. 

Referans yayın: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005. 

İnanılır gibi değil ama makale şu sözlerle açılıyor: “Solunum yolları enfeksiyonlarından mustarip hastalar üzerinde bugüne kadar yürütülmüş yoğun ve detaylı araştırmalara rağmen, hastaların önemli bir bölümünde mikrobiyolojik bir nedene rastlanmamıştır. RNA, saf hale getirilmemiş kültürlerden çıkarılmaktadır.” Ve burada da koronavirüs genlerinin bulunduğu bir PCR kullanılıyor. Sekanslama (gen diziliminin oluşturulması) için familya, domain, fonksiyonel yerleşkelere göre düzenlenmiş iki protein veritabanı -PFAM and INterProScan- ile birlikte, nükleotidlerin nasıl birleşmesi gerektiği üzerine “tahmin” yürütmede kullanılan iki de bilgisayar programından yararlanılıyor. Yayında şu ifadeler de geçiyor: “Genler tarafımızdan manuel olarak bir araya getirilip sekanlanslanmış olup, ardından da virüs genomuna ait dizilime son halini vermek üzere düzeltme yapılmıştır [editing].” Ve bu çalışmada da herhangi bir kontrol düzeneği görmüyoruz.  

MERS-CoV Coronavirus. 

Referans yayın: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012. 

Genetik materyal, High Puré Viral Nucleic Acid Kit adlı bir gereçle doğrudan kültür üst fazı ve balgam numunesinden ekstrakte edilip ardından da farklı PCR’larla, bilinen türlü mikroorganizmalarla eşleşiyor mu diye bakılıyor. Pürifikasyon yapıldığına dair bir bildirim göremiyoruz yayında ve kontrol düzeneği yine yok

Kısacası, daha ilk koronavirüslerden itibaren (ve “virüs” olduğu öne sürülen diğer diğer pekçoğu için de) yapılmış olan şey şu: Enfekte olduğu varsayılan (her ne “sitopatik etki” gözlemleniyorsa bunun bir tek virüs mevcudiyetine bağlı oluşabileceği varsayılıyor) dokular kültürlenip ya buradan birtakım proteinler elde ediliyor ve hiçbir teste filan tabi tutulmadan “virüs antijenleri” ilan ediliyorlar ve sonra bu “antijenler” olur da doku kültürlerinde de çıkarsa [burada tespit edilirse] bunu da “izolasyon”dan sayıyorlar veyahut da, virüse ait olduğu önkabulüyle kültürden birtakım nükleik asit fragmanları çıkarılıyor [ekstraksiyon].    

Bir önceki sayıda yer verdiğimiz makaleden hatırlayacağınız gibi, Dr. Stefan Lanka’ya göre bu “sitopatik etki” denilen şey esasında bizzat kültürün içine sokulduğu koşullardan kaynaklanmakta. Bu durum, Andrea Németh ve arkadaşlarının 15 Ağustos 2017 tarihinde Nature dergisinde yayına giren Antibiyotik uygulamasına bağlı olarak açığa çıkan, yüzeyle ilintili DNA’ya sahip küçük ekstraselüler [hücredışı] veziküller (eksozomlar) başlıklı yayınlarında da tanımlanmış durumda.  

Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf)

Burada açıklandığına göre, laboratuvar deneyi [in-vitro deney] yapılırken hücre kültürüne dışarıdan eklenen bazı maddeler, örneğin antibiyotikler, oluşturduğu stresle daha önce kültürde varlığı saptanmayan yeni birtakım gen dizilimlerinin ortaya çıkmasına neden olabilmekte. Bu durumun, 1983’te Nobel ödülünü kabul konuşmasında bizzat Dr. Barbara McClintock tarafından da dile getirilmiş olduğunu hatırlatalım. 

https://www.nobelprize.org/uploads/2018/06/mcclintocklecture.pdf

İşin özü şu ki, İNSANA AİT KORONAVİRÜS OLARAK ADDEDİLEN YEDİ VİRÜS DE GERÇEKTE İZOLE EDİLMEMİŞTİR. Birbirlerinden tek farkları kullanılan laboratuvar prosedür ve teknikleridir, ki bunlar da gitgide daha sofistike hale gelmiş, ancak bu sofistikasyon daha doğru sonuçlar elde etmek olarak değil, kanma ve kandırmacaya daha müsait bir zemin oluşturma olarak tezahür etmiş, bu durum SARS-CoV-2 diye bir şeyin kağıt üzerinde yoktan var edilmesi, resmen icat edilmesi ile doruk noktasına ulaşmıştır. 

Böyle bir virüs izole filan edilmemişse, buradan çıkacak sonuç bittabii ki bu tür “koronavirüsler”in herhangi bir hastalığın sorumlusu olarak gösterilemeyeceğidir. Dahası, bahsi geçen “virüsler”e ait olduğu öne sürülen yapı ve bölümler (nükleik asitler veya proteinler) üzerinden düzenlenmiş her ne tür test düzeneği olursa olsun hiçbir şekilde ne “enfeksiyon testi” olma vasfına ne de “tanı testi” olma hükmüne sahiptirler.

YANITSIZ KALAN SORULARA YENİLERİ EKLENİYOR 

Önceki sayıda, SARS-CoV-2 “virüs”ünü izole ettiklerinden bahseden bilimsel yayınların yazarlarına yöneltilmiş sorulara gelen yanıtların derlemesini sunmuştuk. Bu yazarlar virüs için “saflaştırma” prosesinin yapılmamış olduğunu kabul ve ikrarla, esasen virüsün izole de edilmemiş olduğunu kabul etmiş oldular. Ve şimdi bu kanıtlara bir yenisini daha ekliyoruz: Farklı ülkelerin resmi yetkililerince (siyasi idare ve sağlık bakanlıkları nezdinde) SARS-CoV-2 izolasyonu ve pürifikasyonuna [saflaştırma] dair sorgulamalara verilmiş yanıtlar.  

James McCumiskey’den –Son Tezgah: Biyomedikal Paradigma (The Latest Conspiracy: The Biomedical Paradigm) kitabının yazarı- öğrendiğimize göre, İrlanda Milli Virüs Referans Laboratuvarı konuyla ilgili Dublin Üniversitesi‘nden bilgi istiyor, üniversite ise “talebe cevaben verebilecekleri bir kaydın bulunmadığı” yanıtını veriyor. Laboratuvarın hukuki hizmetler birimi direktörü ısrarcı olunca üniversitenin yanıtı şu oluyor: “Üniversite olarak, akademik konuların Bilgi Edinme Hakkı Kanunu gereğince sorgulamaya tabi tutulamayacağı görüşündeyiz.” Milli Virüs Referans Laboratuvarı’nın yapmış olduğu bilgi talebinden şunu anlıyoruz ki, üniversite SARS-CoV-2’yi izole etmiş ve buradan kültürlemeye gitmiş değil. Kabul ve ifade ettikleri tek durum, “diagnostik numunelerde SARS-CoV-2 RNA’sı saptanmış” olması.  

22 Haziran’da bir grup uzman benzer bir sorgulamayı doğrudan İngiltere başbakanı Boris Johnson‘a yapmıştı. Mektupta imzası olanlardan Dr. Kevin Corbett (Imperial College’da akademisyen) ve Piers Corbyn (mühendis, bağımsız araştırmacı) ile o dönemde yaptığımız söyleşiyi de yayımlamıştık. Bunun dışındaki imza sahipleri ise David Crowe, Dr. Andrew Kaufman, Edinburgh’da biyoloji profesörü Roger Watson ile kimyager David Rasnick idi. Bu isimler ortak sorgularına hala bir yanıt alabilmiş değiller! 

Benzer bir başka sorgu, bu defa Kanada’nın Milli Araştırmalar Konseyi’ne yapışmış ve aldıkları cevap şu: “MAK’deki kayıtlar bütünüyle incelenememiş olduğundan üzülerek bildirmek istiyoruz ki, talebinize cevap olabilecek yayın bulunamamıştır.

Buna Kanada, Avustralya, Yeni Zelanda, Avustralya, Almanya, Birleşik Krallık ve Amerika Birleşik Devletleri’nde ‘Bilgi Edinme Hakkı Kanunu’ çerçevesinde benzer sorgulamalarda bulunmuş iki gazeteciyi de eklememiz lazım, zira 5 Eylül itibariyle on iki resmi kurum yapılmış başvuruya yanıt vermiş durumda ve hepsi de aynı şeyi söylüyor; ellerinde Covid 19’a yol açmış olması lazım gelen virüsün izolasyonunu tarif eden çalışma kaydı yok. Sorulara verilen resmi yanıtların detayları şuradan görülebilir: https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-ofcovid-19-virus-isolation/ 

DÜZMECE GENOMUN ÇIKIŞ NOKTASI NERESİ

Bu durumda kendimize sorduğumuz soru şu oldu: Tıbbi yayınlarda bahsi edilen gen dizilimleri -iddia edildiği gibi- yeni birtakım virüslere ait değilse, nereden çıkmış olabilirler? Bu sorunun cevabını bulmak için de, verili gen dizilimini Birleşik Devletler’in Milli Sağlık Enstitüleri’nde kayıtlı tüm dizilimlerle kıyaslamamıza olanak verecek bir ‘dizilim sırası arama gereci’ olan Basic Local Alignment Search Tool (BLAST) adlı bir bilgisayar programı kullandık. (ABD’nin milli sağlık enstitüleri kamusal erişime açık olup şuradan sorgulama yapılabiliyor: https://blast.ncbi.nlm.nih.gov/Blast.cgi.)  Neyi nasıl yaptığımızı burada sizlere adım adım anlatacağız ki, okurlarımız da girip aratsın ve sonuçların sağlamasını yapabilsin. 

Önce WHO’nun internet sitesinde o zaman gösterilmekte olan protokollerde tanımlı PCR inisiyatörlerinin [başlatıcılar] hepsini topladık:  

– Çin CDC’sinin protokolü: hedef olarak ORF1ab ve N genlerini kullanıyor.

– Fransa’nın Pastör Enstitüsü’ne (Pasteur Institute) ait protokol: RdRP geninin iki fragmanını kullanıyor (RdRP geninin SARS-CoV-2’ye özel bir gen olduğu iddiası var). 

– Birleşik Devletler CDC’sinin protokolü: N geninden üç fragman (parça, bölüm) kullanıyor. 

– Japonya’nın Milli Enfeksiyon Hastalıklar Enstitüsünün protokolü: Diğer koronavirüsler ile ortak olduğu öne sürülen diğer genlerin yanırısa, hedef olarak S genini kullanan tek protokol bu.  

– Charite Protokolü (Almanya): E, N ve RdRP genlerini kullanıyor. 

Hong Kong Üniversitesi‘nin Protokolü: ORF1b-nsp14 ve N genini kullanıyor.

– Tayland Milli Sağlık Enstitüsü protokolü: N genini kullanıyor.

Ardından BLAST programına primerlerin dizilimlerini (aranan dizilimin başı ve arama yönüne göre de sonunu gösteren sekanstır bu) girdik ve bunları hem mikrop hem de insan genomlarının toplamından oluşan iki veritabanında arattık.

SARS-COV-2’DİR DENİLEN SEKANSLAR HEM İNSAN HEM DE MİKROP GENOMUNDA OLAN SEKANSLAR!

Fransızların protokolündeki inisiyatörlerden örnekle, prosedürün nasıl işlediğinin ayrıntısına girelim. İnternetten BLAST programının sitesine girdikten sonra, mikrobiyel genom veritabanında arama yapmak için Microbes’u seçtik ve sonraki sayfaya geçtik. Sonra, ekrana gelen formda ilgili yere, Fransızların protokolünün düz inisiyatörüne ait dizilimi (ATGAGCTTAGTCCTGTG) girdik. Yakınen benzeşen (“highly similar”) dizilimler seçeneğini işaretledik ve BLAST tuşuna batık. Birkaç saniyede sonuçlar ekrandaydı, ekran görüntüsünü aldık (1 no’lu resim) ve kimliği %100 bilinen mikropların gen dizilimlerinden oluşan ve girdiğimiz hedef dizilim ile %77 ila %100 oranında örtüşen 100 adet mikroba -bilhassa bakteri ve arkeye- ait gen dizilimi çıktı karşımıza.  

Buradan tekrar ana sayfaya geçip, bu defa da İnsan (Human) seçeneğini işaretleyip aynı dizilimi insan genomunda arattık ve birkaç saniyede ekrana gelen sonuçların yine ekran görüntüsünü (2 no’lu resim) aldık. Meğer bu gen diziliminin %66 ila %100 oranları arasında eşleştiği ve bilinirliği %100 olan tam 74 dizilim varmış insan genomunda. 

SARS-CoV-2’ye özeldir denilen bu PCR başlangıç primeri, insan genlerindeki 74 kısımla örtüştüğü yetmiyormuş gibi, mikrop genlerine ait fragmanların da 100’üyle çakışıyor!

Bir de testen yazıldığındaki (bitiş) primeri (CTCCCTTTGTGTGTGT) için aynı işlemi tekrarladığımızda sonuçlar benzer çıktı.

Bunlar oldukça kısa dizilimler (sekans) olduğundan (topu topu yirmi kadar genetik harf yahut nükleotidden oluşuyorlar), bir kez daha arama yapalım ama bu sefer bu iki primerle başlayıp biten hedef sekansa (yani SARS-CoV-2’ye ait olduğu iddia edilen genomun, başta ve sonda bulunan bu iki primer arasında kalan bölümüne) bakalım istedik. Bunu yapabilmek için de haliyle, resmi makamlarca “SARS-CoV-2 genomu” ilan edilmiş dizilime ihtiyacımız var. Biz bu virüsü izole ettik ve sekansladık diye ortaya çıkan binlerce laboratuvar var (ki önceki raporlarda açıkladığımız gibi asılsız iddialardır bunlar), ancak biz Milli Biyoteknoloji Bilişim Merkezi’nin internet sitesini (https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2? report=genbank&to=29903) tercih ettik. Siteye girdiğimizde “hedef dizilim”i bulduk; “genom”un 12,690 ve 12,797 konumları arasında kalan 108 nükleotidlik bir fragmandı bu: ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACAACAACAAAGGGAG

Bu defa da bu dizilimle yukarıda anlattığımız işlem basamaklarını aynen tekrar ettiğimizde sonuç yine şaşırtıcıydı, zira mikrop genlerinden %100 eşleşme gösteren yüz adet dizilim de burada çıktı, yanında da insan genomundan %83 ila %95’lik benzeşme oranı ile dört dizilim bulduk. Bundaki eşleşme sayısı daha az evet, fakat burada önemli olan, SARS-CoV-2 diye servis edilen “hedef dizilim”e ait bölümleri istikrarlı şekilde hem mikroplarda hem de kendi genomumuzda buluyor olmamız.

Hayretler içerisinde, bari bir de bu virüsün en belirgin ve kati genidir denilen ve zarf proteinlerinin üretiminden sorumlu olduğu öne sürülen, yeri 26,245 ve 26,472 konumları arasındaki bölüm olan E genini girip aratalım diye düşündük. Bahsi geçen E geni şu: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA.

Aynı işlemler üzerinden bu geni arattığımızda sonuç daha da şaşırtıcı oldu. Bunca uzun bir dizilim olmasına rağmen kimliği %100 tanımlanabilen 100 adet mikrop sekansı da bununla eşleşti, üstüne de %80 ila %100’lük eşleşme oranıyla insan genomuna ait 10 dizilim bulundu. Rastgele aldığımız bir gen bölümünden yine benzer sonuç aldık, ayrıca bir de SARS-CoV-2 nükleokapsidinin proteinlerine karşılık geliyor dedikleri N genine baktığımızda da yine benzer eşleşmeler gördük.

Son olarak bir de şu hücre içine girmede kilit roldeki yapısal “spike” proteinlerini yapıyor, o bakımdan da SARS-CoV-2’nin en spesifik genidir dedikleri S genini test edelim dedik. Bu, 21,563. ve 25,384. konumlar arasındaki 3821 nükleotidden oluşan çok daha uzun bir dizilim olduğundan iki yerden rastgele seçtiğimi bölümlerini alıp arattık ve arattığımız ilk bölüm (TTGGCAAAATTCAAGACTCACTTTC) bir diğer 100 mikrop geni sekansı ile 93 de insan gen sekansına karşılık geldi, ikinci bölüm (CTTGCTGCTACTAAATGCAGAGTGT) de mikrobiyel gen sekanslarından 100’ü ile isan gen sekanslarının 90’ıyla eşleşti. 

S genini hedef dizilim olarak kullanan tek ülke olduğundan Japon Protokolü’nün inisiyatörleriyle araştırmamızı sonlandıralım istedik ve okuyucunun çoktan tahmin etmiş olacağı üzere bunda da oldukça yakın sonuçlar elde ettik: mikroplara ait gen dizilimlerinden 100’ü ile, aidiyet oranı %94.12 ila %100 arasında değişen, insana ait 93 gen dizilimi ile örtüşme!

SONUÇ 

Tüm bu anlattıklarımızdan çıkarımlanacak sonuç gayet açık: SARS-CoV-2 TESPİTİ YAPMADA KULLANILACAK GEÇERLİ TEST YOK DÜNYADA; ne antikor veya antijen testi ne de RT-PCR. S1 diye geçen spike proteinini kodladığı iddia edilen gen üzerinden çalışanları da dahil ettik. Yani bu tam olarak şu demek: TÜM BU “VAKA”, “ENFEKTE İNSAN”, “HASTA”, “ASEMPTOMATİK” YAHUT “COVID-19 ÖLÜMÜ” SAYI VE İSTATİSTİKLERİNİN HİÇBİR BİLİMSEL TEMELİ YOK VE TÜM “POZİTİFLER” DE HATALI POZİTİF. Bu bilginin insanlara bir an evvel verilmesi, sorumluların da kanun önünde hesap vermesi lazım. 

Bu bölümü kapatırken, WHO’nun bile bu testlere itimadının olmadığını eklemek istiyoruz. Bunun için 11 Eylül’de SARS-CoV-2 laboratuvar kılavuzu olarak yayımladıkları belgeye bakmak kafi (Diagnostic tests for SARS-CoV-2https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve). Sayfa 5’te aynen şu söyleniyor: “Şüpheli aktif enfeksiyon vakaları mümkün mertebe RT-PCR gibi bir nükleik asit amplifikasyon testi (NAAT) ile test edilmelidir. NAAT testlerindeki hedef gen SARS-CoV-2 genomundan olmalıdır, lakin şu anda dünyada SARS-CoV-1 dolaşımı sözkonusu olmadığından, hedef olarak bir Sarbekovirüs dizilimi de (aralarında SARS-CoV-1 ve SARS-CoV-2 de olmak üzere insan ve hayvan koronavirüslerinden en az beşini ihtiva ettiği düşünülen virüs dizilimi) kullanılabilir.” Yani WHO, SARS-CoV-2 tetkiki için non-spesifik dizilim kullanımını onaylıyor. 

Sırf bu da değil, kılavuzda daha sonra deniyor ki, “Optimal teşhis, SARS-CoV-2 için genomdan bağımsız en az iki hedefin tanımlı olduğu bir NAAT testi ile yapılmalı, ancak hastalık bulaşının yaygın olduğu yerlerde teşhis için basit bir ‘tek hedefli’ algoritma da kullanılabilir.”

WHO kılavuzunda göre , “Bir veya iki negatif sonuç alınmış olması SARS-CoV-2 enfeksiyonu olmadığı anlamına gelmez. Enfekte bir bireyde sonucun negatif çıkmasına neden olabilecek çok sayıda faktör vardır, bunlar arasında örneğin alınan numunenin düşük kalitede olması, geç aşamada alınmış olması, düzgün muhafaza edilmemesi yahut testle ilgili virüsün mutasyona uğraması veya PCR inhibasyonu gibi teknik nedenler sayılabilir.”

Soruyoruz. Bu ülkenin hakimleri savcıları harekete geçmek için ne bekliyor?

Jesus Garcia Blanca 

Not: Yazar, bilimsel makale taraması ve BLAST programı ile girişilen ziyadesiyle ayrıntılı ve emek isteyen çalışmalardaki sabrı ve yardımları için Juan Pedro Aparicio Alcaraz’a teşekkür eder.

Raporun yayımlandığı adres: https://www.dsalud.com/revistas/numero-242-noviembre-2020/

Okumaya Devam Et

Somatoscope

  (Bu videolar bakteri oluşum görüntülerinin tüm aşamalarını değil sadece 13 aşamasını göstermiştir.) Sormamız gereken önemli bir soru var:Modern...

Peki Ama Bu İnsanlar Neden Ölüyor?

COVID-19 Resmi Mortalite Verileri Yaşanan Ölümlerin Viral Hastalık Kaynaklı Olamayacağını, Ana Etmenin Tedavi için Kullanılan İlaçlar Olduğunu...